Home

全ページダウンロードはこちら

image

Contents

1. 10 34 000 1 1 0 4 10 37 000 1 1 0 80 90 a 26 000 90 ES 40 000 KLH 40 000 5 10mg 10 15mg 8 10 10 000 2 150 000
2. y y 3
3. GD 10C 4C 1 GD 2 lt W gt 4 gt 30 1 i SDS
4. UpLoad No 75 MF 1 C57BL 8 PBS N 3 60mm 1 PBS 10 FCS DMEM 100mm 1 x105 2 4X102 MF A
5. 1 1 50965 300 100 300I 0 g 30 g 5 15 20 60 2 RNase inhibitor 80 180 RRNase inhibitor 12 34 5 kDa Ver 1 100 75 300I 1 1 3 lt 50 lt 37 1 Fyn Ver 1 ene 2 Fyn Ver 2
6. 1 616 NOTICE TO PURCHASER LIMITED LICENSE OW 9 A license under U S Patents 4 683 208 4 683 195 4 965 188 and 5 075 216 or their foreign counterparts owned by Hoffmann La Roche Inc and F Hoffmann La Hoche Ltd Roche has an up front fee Lloyd s Register Qual ty Assura nce LRQA component and a running royalty component The purchase price of 2 this product includes Imited nontransferable rights under the running ISO 9001 royalty component to use only this amount of the product to practice QS 2 the Polymerase Chain Reaction PCR and related processes described in said patents solely for the research and development Hestriction Endon ucleaseS Modifying activities of the purchaser when this product is used in Conjunction with a thermal cycler whose use IS Covered by the up front fee Enzymes
7. SPR SPR SPR SPR 96 SPR NTA HisS His Flag Myc Flag Myc 1 His
8. CDNA DNA DNA e DNA e 100 000 100bp 30 000 50Obp1 501 1000bp 4 1001 000bp 5 SG00 1 bp
9. LineGene nd Derivative Maximum Fit Points Fit Points Baseline Threshold Baseline Threshold PCR LineGene Baseline Threshold
10. DNA I DNA SNP Typing Kit Thiopurine methyltrans ferase 3C 719A G PCR Cycler BioRad _ sa PCR DNA PCH PCR UpIo3d Go 1 95C 30 sec 65C 930 sec 72C 30 sec 1 72C 5 min min a 4 1 1 TPMT GC PCR 608 bp Fig 1 A G
11. 1sEr 19EHOH Fit Points Ct e HHHHHHHHHHHH HUr3 5 1 gg S45 BEB Thrashald Blina 1 p Basslra tf b Bese line 7 ase d Basile 9 Eslrs 1 aggln aa ke Bae asalrs pire Ensalre mmmhnewm Esseireei 3 Baseline Threshold Threshold gal agamlramaLi zarashiT asmirma ammlrmgiHIH mmlrmsit Hagane Finss hms Em mmlhrr Fsmlrmm amsmlr an _ Bawaima 1 _ rai Baseline Threshold LineGene 1 PCR Tips 94 99 1997
12. 00 000 50ug 20 000 1kbD cDNA 3 PCR CDC 101 230 000 1kb 0 5 CDC 108 80 000 1 1 kb 1 1 93 5x 107cells 100mg Total RNA Total RNA 1mg mRNA 0 5 dT CDC 104 100 000 C
13. 1 7 VFXW 1 000 A 2 3 WH Tr 1 pg 1 El Ep mh al Hi primi mm Et F mh
14. component Hights to the up front fee component must be obtained by the end user In order to have a complete license to use this product in the PCR process These rights under the up front fee component may be purchased from Perkin EImer or obtained by 180 14001 purchasing an authorized thermal cycler No right to perform or offer 1 4001 commercial services of any kind using PCR including without limitation reporting the results of purchaser s activities for a fee or other commercial consideration is hereby granted by implication or JAB estoppel Further information on purchasing licenses to practice the JIC PCR Process may be obtained by contacting the Director of J J AB Licensing at The Perkin EImer Corporation 850 LincoIn Center Drive Quality AssSuranCe Ltd ISO 1400 1 NESEIIHIEIRI NE Foster City California 94404 or at Hoche Molecular Systems Inc J No E004 RE 002 1145 Atlantic Avenue Alamada California 94501 O
15. UpIo3d 4 2 96 4 384 1 VFXW 1000 9 5 4 10 20 18 1 96 4 5 384 1 2 _ 96 4 384 1nishiyal THAME EWE SF MD 01 0W WIT mlm mm si 3 me ry MR ip 3
16. pUC19 1X107 1xX106 1x105 1 104copies pUC19 1498bp M13 Primer P7 Code No PRM 007 CGCCAGGGTTTTCCCAGTCACGAC M13 Primer P8 Code No PRM 008 AGCGGATAACAATTTCACACAGGAAAC 3 PCR SYBR Green Realtime PCR Master Mix Code No QPK 20 1 PCR mix 1 x102copies 16 PCR mix 1x107 1 106 1X105copies PCR mix PCR UpIo3d 7 4 19 PCR mix gt SYBRS Green Realtime PCR Master Mix 5 mix 10uM each 0 8 pUC19 1 ul 3 8 10 lt gt 95C min 95C 5sec 60C lsee ssoes 72C 0sec gt Channel Fl1 Gain 60 LineGene Baseline 1
17. G SNP Typing Kit TPMT 3C kit A specific Primer G specific Primer M 1 2 3 4 5 6 7 8 9 10 603bp Lane M Haell digest Lane 1 6 negative control Water Lane 2 7 TPMT 1 1 Lane 3 8 TPMT 3C 3C Lane 4 5 9 10 Patient DNA 1 ASP PCR detection for TPMT GC MM GAAAAGI TATATCTACTTACAG Electropherogram sense strands for the TPMT gene at exon 10 Wild Wvild A719A Seqguence was determined using ABI PRISM 310 Genetic Analyz
18. PCR PCR 38 SG004 9 81 8004 11 18 090 OF 1 units Code No 4gz I 500Ux1 AAT 211 Alu I 500UX1 ALU 101 000 Am44 1 10 000 5 000 4pg 1 5 000Ux1 APA 101 5 000 Ase 1 11 000 5 500 Avg I 200Ux1 AVA 101 BamH 1 3 000Ux1 BAH 111T Ban 1 12 000 6 000 Ban 4 000Ux1 BAN 211 15 000 gg II 15 000 7 500 gn 200Ux1 BAN 311T 5 000 rP 1 15 000 7 500_ o I 500UxX1 BCL 101 9 000 1 11 000 5 500 Bgl 1 1 000Ux1 BGL 101 BssHI 100Ux1 BSH 201 5 000 Bsm 1 11 000 5 500 gsfEI 3 000Ux1 BST 211 12 000 BsiW 1 1 5 0OO BstX 1 500Ux1 BSX 101W 10 000 C 10 1 15 000 7
19. 2 20 units CodeNo f ATP Dependent DNase 00UX ADD 101 10 000 5 000 Bal31 Nuclease 50UX1 BAL 301 Alkaline Phosphatase E coli 100UX 1 BAP 1 1 1 1S 000 7 500 Alkaline Phosphatase Calf Intestine 1 000UX1 CAP 101 E coli DNA Ligase 1 000UX1 DLG 10 12 000 6 000 DNA Polymerase 1 500UX1 DPL 101 Exonuclease 5 000UX 1 EX0 30 1 10 000 5 000 T4 DNA Ligase 400UX1 LGA 1 1 1 AMV Reverse Transferase XL Life Science Inc 500UX 1 LSLME704 35 000 17 500 Mung Bean Nuclease 2 000UX1 MBN 101 Klenow Fragment DNA Polymerase I Large Fragment 400UX 1 PLA 1 1 1 1S 000 7 500 T4 Polynucleotide Kinase 1 500UX 1 PNK 1 1 1 Tth RNaseH 1 000UX1 RNH 0 1 15 000 500 M MLV Heverse Iranscriptase HNaseH 10 000UX1 RTM 101 RNase Inhibitor 2 500UX 1 SIN 101 9 000 4 500 T4 DNA Polymerase 100UX1 TPL 101 Te Thermo T7 RNA Polymerase TT7 7 500UX1 TRL 201 182 000 6 000 ReverTra Ace 10 000U TRT 101 3 0C Code NO 100Dbp DNA Ladder 100 DNA 030 15 000 500 200bp DNA Ladder 100 DNA 031 1 Tkb DNA Ladder 300 DNA 03 000 11 000 Loading Quick 100bp DNA
20. BTQ 201 2004 9 1 2004 1 1 30 30 OFF P 2 UpIo3d 7 4 21 ye1 000 aE Realtime PCR Master Mix Realtime PCR Master Mix 2004 7 1 Realtime PCR Master Mix Realtime PCR Master Mix x 00 1mlX5 QPK 101 3 9 000 37 000 SYBR Green Realtime PCR Master Mix gt 00 1mlX5 QPK 201 39 000 37 000 50 I P G 7 1
21. 5 xLigation Buffer T Ds a CoeY GD 4 PCR eet KOD DNA PC PCH TA PCH 7g9 DNA dJA A attachment Mix PCR TA TArgetClone Plus TA A attachment Mix
22. G5ml 4 160 000 1 300 000 A IgG 85ml 3 1820 000 1 400 000 DEAE 85ml 3 160 000 1 400 000 1000 ELISA ODO 5 http www toyobo co jp seihin xr product custom index html Le NEW RELEASE 5 cgre s g86
23. 2mmat ll W 1 We 1 B 4 5 i EA 1 F 6 4 394 1miehiral ls HE Et DAD EE VFXT 1000 193 96 6
24. TPMT SC TPMT 6 9 1 TPMT 3C 6MP FDA 6MP TPMT TPMT 6MP TPMT TPMT 3C kit
25. 4 10 FCS DMEM MF MF Collagen I MF FN 1 1 1 MF 10 FCS DMEM 5 MF I MF Collagent1 MF FN MF ECM 3 4 1X 105 4x 104 1096FCS D
26. T Control Hs0O 3 Insulin 10nM 5 2 Insulin 1nM 5 4 Insulin 100nM 5 Dhospho ERK ERK 250ml NKB 101 30 000 50ml NKB 101T 10 000 Can Get Signal Solution 1 for Drimary antiDody S50ml 1 NKB 20 1 17 000 Can Get Signal Solution 2 for Secondary antiDody Santa Cruz S50ml 1 NKB 301 17 000 PeproTech Fitzgerald Lumino Imaging Analyzer FAS 1000 CCD FAS 1100 CCD FAS 1000 2 500 000 ga ao gg FAS 1100 3 500 000 10 DP TOYOBO BIOCHEMICALS e e ECHNICAL EVIEVV TPMT 3 SNP Typing Kit 6 6MP Thiopurine S methyltransferase TPMT PhaseI 10
27. 100I min 0 1 Cg ml Myc d9E10 Santa Cruz Flag M Sigma SPR 4 4 His tagged Protein array NN NNN o N o N O O oN N N 9 o o gt Anti Flag WW Anti Myc His O SPR G Flag Flag SPR Myc Myc 4 Anti Flag Anti Myc c10 25 Flag 20 g a 15 F 10 Myc 5 Blank 5 0 1200 2400 3600 Time sec
28. Baseline Threshold 0 5 20 16 G Ct LineGene Fit Points Ct Baseline Baseline Threshold Ct Baseline Threshold G Baseline Threshold Fit Points Ct Thre
29. 1 PCR SP 5 Texas Red P4mer AP 24mer DNA Total 98mer SP 50 mer AP DNA 50 pmoles ca 3X10 3 0 5mM 50 pmoles dNTPs 0O 2mM 1 25U Blend Taq W Plus rTaq 100 ul Duffer Duffer 94 C 5min 94C 30sec 60C 30sec 72C 30sec 0 14 1096 UV FAS Product Primer 50mer 45o 1039 PCR 50pmoles 3x10s
30. Sahara T Goda T Ohgiya S J Biol Chem 51 50015 21 2002 6 500 000 1 1 http www toyobo cO jp seihin xr product custom index html UP TOYOBO F PROTEIOS EE Wheat germ cell free protein synthesis kit Ver 2 PROTEIOSW Ver 1
31. Blend Taq Plus 2 1 10 rTaq 4 6 14 2 Blend TaqW Plus rTaa 16 Blend Taq Plus 60 Primer Product 50 40 30 FIuorescence 20 1 Blend Taq Plus rTad Primer Product Fluorescence 5 10 Cycles 6 rTaqd Code No PCR Blend Taq _Plus Hot Start version Blend Taq Plus 2 5U ul 10xbuffer for Blend Taq mM dNTPs 50Ux 1 S50UX1 BTQ 201T BTQ 201 6 000 PCR Polymerase Chain Reaction F Hoffmann La Roche 4 683 195 4 683 202 PCR F Hoffmann La Roche PCR
32. 6 ECL Plus Amersham Biosciences LAS 3000 1 Akt ERK Akt ERK Can Get Signal TBS T Western blot Can Get SignaI TBS T Can Get Signal 1 2 3 4 Akt WNW T Control HzO0 3 Insulin 10nM 5 2 Insulin 1nM 5 4 Insulin 100nM 5 1 Dhospho Akt Akt Can Get Signal Immunoreaction Enhancer Solution SQlution 1 for Drimary antiDody SQlution 2 for secondary antibody Can Get 5 g77g M 3 4
33. Hybond P PVDF Amersham Biosciences 3 TBS tween TBS T 10mM Tris 0 15M NaCl 0 1 Tween 20 50ml BSA Bovine serum alDumin 0 5g 1 BSA TBS T PVDF 1 UpIo3d 4 4 1 1 Can Get Signa Solution 1 1 2 000 PVDF 1 TBS T 10 X3 TBS T 1 1 phospho Akt Cell Signaling Technology Dhospho ERK Santa Cruz 5 2 2 Can Ge Signal Solution 2 1 20 000 PVDF 1 TBS T 10 x3 TBS T HRP LAmersham Biosciences HRP Amersham Biosciences
34. 12cecO 9 1 tache a 0 ME Th 4 3 5 2 66 e Am 6 EO 8 HE i TAch 0 RL 4 1 VE Mermo me ABI394 pia 8 50 L a MA 1 MY G 9G 84 Ss 8 1 1 1 ub 1 VIEMn p me ABI394 p m5 50 L 1 FE 19 0 1 ia 17 4 9G 364 MMW 6 4 36 Tnishiivat PARE my 1 5 1 2 3 20 1 2 3 d6 4 384
35. Ca Can Get 5 g77g WV Western blot ELISA enzyme linked immunosorbent assay Can Get Signal Western blot Akt ERK Extracellular Signal regulated kinase 1 1nM 10nM 100nM Hs0 5 Cell lysis buffer SDS lysis buffer 35C 5 10 g 129 SDS
36. KOD TA A attachment Mix KOD PCH A attachment Mix PCR 60C 10 PCRH A attachment Mix 3 dA 60C 10min 7g9 DNA PCRH TA pTAS 24C 5 30min Cm 37C over night 1 PCR TArget Clone Plus Code No TAK 20 1 UP NEW RELEASE 100 pr Method 1 Tag PCR go Method 2 KOD PCR Method 3 KOD PCR A attachment Cloning efficiency 1 2 3 Method KOD dA KOD DNA TA KDD PCRH A attachment Taq PCR
37. Myc Flag 3 Flag Myc SPR 1 Kinetics G Kinetics 1 Kinetics SPRH Anti Flag Anti Myc Fag wc Blank i ka S Anti Flag 1 4x107 3 3x10 3 2 4x10 Anti Myc 5 1X10 5 2X10 1 0X10 1 Gershon P D Khilko S J Immunol Methods 183 65 76 1995 2 Sigal G B Bamdad C Barberis A Strominger J Whitesides G M Anal Chem 68 490 497 1996 3 Kroger D Liley M Schiweck W Skerra A Vogel H Biosens Bioelectron 14 155 161 1999 4 Gamsjaeger R Wimmer B Kahr H et al La
38. 0 1 KOD 201 KOD 202 KOD 203 TAP 201 TAP 202 TAP 205 6 000 21 000 30 000 120 000 30 000 5 000 00 000 99 000 Blend Taq Blend Taq Plus 004 9 1 5004 1 1 30 3092OFF P Competent Cell Competent high DH5g Competent Cell DH5 go SOC 1mlx 10 Positive Control Plasmid 0 1mlX10 DNA 903 17 000 PE ECHNICAL EVIEVV Can Ge7 Signal Western blot Western blot
39. Bal 9 iri 5 Tp mi gaL i Personal Laboratory Automation System VFX 1000 Laboratory Automation VFEX series VF X Ver 3 0 Personal LaDoratory Automation System VEX 2000 VFX 2000A 6 000 000 Personal Laboratory Automation System VEX 2100 VFX 2100A 7 000 000 18 ECHNICAL EVIEVV LineGene LineGene 0 oml x39 Rg PMT
40. UpIo3d 7 4 Au S COOH HaC N C a 3C N C N NCH HO N EDC 4 NHS Au woo O CHzCOOH HaN CH2 s CH N CH2COOH AB NTA COOH CH COOH Au SR CONH CH 4 CH N CH COOH COOH 1 NTA 3 1 5mM NiCls 300ul NTA 5 NTA Ni 2 Flag Myc PBS 100 MultiSPRinterW NTA Ni His PBS 4 SPR MultiSPHinterW SPR SPRH HEPES 2G0mM HEPES HCI 150mM NaCl pH7 2 550I min 10
41. 4C 20C TADM 250 0 000 BB PBS EDTA 50C TSC K 10 000 50mlX 1 TCC 050 10 000 TOYOBO BIOCHEMICALS 14 Up e e ECHNICAL EVIEVV JBIRC His His NTA SPR
42. dA 1 A attachment mix Tag PCH DNA 22kb PCR TA TArget Clone 10ul pTA2 Vector 50ng ml 5Oul 2xLigation Buffer 10ul T4 DNA Ligase 4U ml KOD TA TArget Clone Plus 10 pTA2 Vector 50ng ml 5Oul 2xLigation Buffer 10ul T4 DNA Ligase 4U ml 10ul 10XA attachment Mix PCHR TAK 101 11 000 TAK 0 1 13 000 Blend Taqg Blend Taq 2 5U ul 10xbuffer for Blend Tagq mM dNTPs 50UX1 50UX 1 1 000UX 1 1 000UX9 BTQ 101T BTQ 101 BTQ 10 BTQ 103 5 000 19 000 6 000 170 000 Blend Taq Plus Hot Start version Blend Taq Plus 2 5U ul 10xbuffer for Blend Taq mM dNTPs KOD Plus KOD Plus 1U ul TOXPCR buffer 85mM MgS04 mM dNTPs rTaq DNA Polymerase Mg rTaq DNA Polymerase 5U ul 10xbuffer 5mM MgCls mM dNTPs 50UX1 550Ux 1 500UXx 1 500UX 5 500UX1 1 50Ux 1 50U 1 1 50UX 5 BTQ 2G01T BTQ
43. VJ 52 1 IS01400 1 O a 2 UPIo39
44. ee LineGene Realtime PCR Master Mix x 00 1mlX5 40 1mlx 1 BFFQD 33A 3 790 000 QPK 101 37 000 QPK 101T 10 000 SYBR Green Realtime Master Mix x 200 1mlX5 40 1mlx 1 50AI SYBRH Molecular Probes QPK 201 37 000 QPK 201T 10 000 OO5W QPK 0 1 QPK 0 1 2004 9 1 5004 1 1 30 3092OFF P 20 ECHNICAL EVIEVV Blend Taq Plus PCR PCR Blend Taq W Plus
45. 3 DHFR Ver 1 25 4 DHFR Ver 2 5 DHFR Ver 1 20 1 4 RI 1 lt 10 5 CBB Src family kinase Fyn DHFR PROTEIOS Wheat germ cell free protein synthesis kit Ver 2 Wheat germ cell free protein synthesis Core kit 5 CPS 801M Wheat germ extract Creatine kinase S20 80C 20C CPS 80 1 Buffer 1 Buffer 2 2 RNase inhibitor 60 CPS 803 Plasmid set pEU3 NII pEU DHFR ScriptMAX Thermo T7 Transcription Kit 0 X60 P0C TSK 101 8 000 6 10 Microsome High IVT 8001 480 000 8 38 Plasmid set PROTEIOSW RNA PROTEIOS set PROTEIOS PG Mate e TEL 075 7 1 81 1 1 FAX 075 71 1 6019
46. WEB http Www wakenyakU CO jp TOYOBO BIOCHEMICALS Up ef Te 7 NEW RELEASE KR TArget Clone TArget Clone Plus E TA TA PCHRH TA DNA TA 1 xLigation Buffer
47. gr 1 200Ux1 NAR 101 10 000 5 000 Nci I 500Ux1 NC 101 8 000 Nco 1 200Ux1 NCO 101 5 000 2 500 Nhe I 250UX1 NHE 101 5 000 Not 1 1 000Ux1 NOT 111 Not I 200Ux1 NOT 111T Nru 1 400Ux1 NRU 101W NspV 100Ux1 NSP 101 Pac 1 50Ux1 PAC 101 PpuM I 40UX1 PPM 101 Psi 1 100Ux1 PSI 101 Pst I 18 000Ux1 PST 111 Pst I 3 000Ux1 PST 111T 2 000 Pu 1 200UX1 PVU 101W 10 000 Pu HL 5 000Ux1 PVU 211 18 000 6 000 Rsa I 1 000Ux1 RSA 101 8 000 Sgu3A 1 200Ux1 83A 101 5 000 Saug96 1 300Ux1 S96 101 Sac 1 5 000Ux1 SAC 111 Sac I 500Ux1 SAC 111T Sac I 3 000Ux1 SAC 211 Sac I 600Ux1 SAC 211T sal 1 5 000Ux1 SAL 111 sal I 1 000Ux1 SAL 111T 7 1 200Ux1 SBF 101 Sca 1 1 000Ux1 SCA 103 ScrF 1 600Ux1 SCR 101 Sfi I 2000Ux1 SFI 111 Sma I 3 000Ux1 SMA 111 12 000 6 000 Sma 1 600Ux1 SMA 111T 6 000 C Spe 1 200UxX1 SPE 101 6 000 3 000 Sph I 600Ux1 SPH 111 12 000 Sph 1 150Ux1 SPH 111T 6 000 3 000O Srf 1 40Ux1 SRF 101 10 000 Ssp 1 300UxX1 SSP 101 6 000 3 000 7gg I 500UX1 TAG 101 TspE 1 200UxX1 TSE 101 11 000 5 500 Xba I 4 000Ux1 XBA 101W 0 5 OOC Xho 1 3 000Ux1 XHO 101 5 000 2 5OO in FE a i PF m
48. 3 0 VFXW GUI Ver 3 0 VFXW 1000 96 x4 384 VF X Ver 3 0 VFXW 1000 1
49. 00 4 47 SNP Typing Kit Cytochrome P450 7 6573 C insert 00 STK 126 40 000 4 47 SNP Typing Kit Cytochrome P450 0D6 S36 Exon9 2D6 2D7 SNP Typing Kit Cytochrome P450 0D6 Duplicate 2D6 x2 S00 ST K 1 STK 128 40 000 40 000 4 47 SNP Typing Kit Cytochrome P450 2 2C9 3 1075 A C STK 101 40 000 SNP Typing Kit Cytochrome P450 2 79 681 G A STK 111 40 000 SNP Typing Kit Cytochrome P450 2C19 3 636 G A Positive Control Set 12 STK 1 1 20 000 Code No Code No P PCR Polymerase Chain Reaction F Hoffmann La Roche 4 683 195 4 683 202 PCR F Hoffmann La Roche PCR 40 000 UpIo3d ECHNICAL EVIEVV MF TM e MF
50. 500 Girial 400Ux1 C13 101 8 000 C79 1 50Ux1 CF9 101 ge I 500Ux1 DDE 101 000 Dpn 1 11 000 5 500 Dra 1 4 000UX1 DRA 103W 10 000 E Eco105 1 18000 6 000 EcoT22 1 4 000Ux1 E22 111 15 000 3 Eoo47 1 9 000 4 500 Eoo47 5 000 Eco52 1 50Ux1 E52 101 5 000 2 50O EcoHR 1 18000Ux1 ECO 111 EcoR II 100Ux1 ECO 201 EooRV 4000Ux1 ER5 101W 10 000 5 000 Fsp 1 200Ux1 FSP 101 Hae 7 000Ux1 HAE 311 Hin1 1 50UX1 HIN 101 Hindm 12 000Ux1 HND 311 6 000 3 000 HindIH 3 000Ux1 HND 311T 4 000 UpIo3d 4 0C units Code No E Hinf I 2 000Ux1 HNF 101W 7 500 3 750 Hpa 1 200Ux1 HPA 101W 0 Hpa IL 2 000Ux1 HPA 201 8 000 4 000 Kpn 1 10 000UX1 KPN 111 18 000 Kpn 1 1 0D00Ux1 KPN 111T 6 000 3 000 Mbo I 400Ux1 MBO 201 Miu 1 1 000Ux1 MLU 101 9 000 4 5OO_ Mro 1 40Ux1 MRO 101 10 000 Msc I 40Ux1 MSC 101 10 000 5 000 Msp I 2 000Ux1 MSP 101 8 000 Mva 1 1 000Ux1 MVA 101 10 000 ge 1 250Ux1 NAE 101 8 000
51. DC 105 5 000 50 g 1 5 20 000 CDNA RNA _ http Www toyobo co jp seihin xr product custom index html 0 5 AGPC CDC 103 100 000 UP NEW RELEASE cDNA
52. His pET16b Novagen TAP Flag Myoc BL 1 CodonPlus DE3 RIL Stratagene Flag Myc 1 5 NTA 1 1 MultiSPRinterrV C00H 300 0 2M EDC 0 05M NHS PBS C0OH EDC 1 3 3 N 20mM Phosphate 150mM NaCl pH7 4 2 0 05M AB NTA PBS 300 NTA 3 1 M 6 pH8 5 300pul NHS PBS
53. Ladder 100 DNA 130 Loading Quick 500bp DNA Ladder 100 DNA 131 15 000 500 Loading Quick 50bp DNA Ladder 100 DNA 133 1 Blend Taq Blend Taq Plus PCR Realtime PCR Master Mix 30960FF SG004 9 1 8004 1 1 30 Blend Tagw Blend Taa PIUS Taq 0 Blend Taq M Barnes PCR Taq DNA Polymerase Proofreading DNA Polymerase PCR Code No PCR Blend Taq ap PCR Blend Taq Plus 13 G00 OF PCR a Code No Realtime PCR Mast
54. MEM MF 0 24x 10 A 0 1096FCS DMEM MF UpIo3d 4 1 X10 13 8 TM Cell Research 10 FCS DMEM MF 3 2 4x 10 A MF 4 Code No MF medium 500mU 4C 20C TMMFM 001 35 000 5ml 52 250ml 4C 20C TPGM 250 18 000 7 70 250ml 4C 0C TAGM 250 20 000 7 70
55. PAGE CBB 1 1 A His B SDS PAGE 8 30 10 P W 1 S A B 30C 1 1 0C 5
56. er 1 Krynetski EY et g Pharmacology 61 136 146 2000 2 Hiratsuka M et al Biol Pharm Bull 23 1090 1093 2000 3 Hiratsuka M et al Mutat Res 448 91 95 2000 4 Ando M er al Pharmacogenetics 1 1 269 273 2001 20C SNP Typing Kit Thiopurine methylItransferase 3C 719 ATG 200 STK 151 40 000 SNP Typing Kit N Acetyltransferase SNP Typing Kit N AcetylItransferase 2 6 SNP Typing Kit N Acetyltransferase 481 C T 590 GA 857 G A G0C CodeNo 2004 2005 S00 STK 131 40 000 S00 STK 132 40 000 SNP Typing Kit Glutathion S transferase A1 69 C T 00 STK 14 1 40 000 SNP Typing Kit Alcohol dehydrogenase 47Arg HiS STK 161 S00 STK 133 40 000 5 40 000 SNP Typing Kit Aldehyde dehydrogenase 487G A STK 162 40 000 SNP Typing Kit Cytochrome P450 2850 C T STK 1 1 40 000 SNP Typing Kit Cytochrome P450 0D6 4 1846 GA ST K 1 40 000 SNP Typing Kit Cytochrome P450 6 whole deletion STK 123 40 000 SNP Typing Kit Cytochrome P450 6 7 100 C T 00 S1K 1 4 40 000 4 4 SNP Typing Kit Cytochrome P450 6 7 1758 GA 00 STK 1 5 40 0
57. er Mix x2 00 1mlX5 QPK 101 SYBRY Green Realtime PCR Master Mix x2 00 1mlX5 QPK 20 1 5OI PCR Polymerase Chain Reaction F Hoffmann La Roche 4 683 195 4 683 202 PCR F Hoffmann La Roche PCRH TOYOBO BIOCHEMICALS ef Te 2 7 NEW RELEASE DNA DNA
58. ngmuir 20 5885 58980 2004 5 Wegner G J Lee H J Marriott G Corn R M Anal Chem 75 4740 4746 2003 6 Rigaut G Shevchenko A Rutz B et al Nature Biotechnology 17 1030 1032 1999 Code No Surface Plasmon Resonance Imaging System MultiSPRinter SPR SPR 101 16 000 000 MultiSPRinter Au MultiSPRinter NHs MultiSPRinter COODH Code NO SPR 200 1 4C SPR 0 1 0 000 8 19 1 4C SPR 202 20 000 8 19 ECHNICAL EVIEVV VFXW 1 2 20 ul 200 ul 1000 uu VFXW 1 000 VFX 2000 VFX 2100 VF X Ver
59. shold LineGene Baseline Threshold Threshold 1 1 10 G Baseline Threshold 1 10 Baseline Threshold Baseline Threshold TW 18EGH Pnd Derivative Maximum EE Ct

Download Pdf Manuals

image

Related Search

Related Contents

® MT800-2 EVP EU  Manuel d`instructions - Instructions Manuals  ebode IMRF  取扱説明書 - ヒビノプロオーディオセールス Div.  Image IMTL19905 User's Manual  Benutzerhandbuch    FlashlightDVR™ - MCM Electronics  Mise en page 1    

Copyright © All rights reserved.
Failed to retrieve file