Home

22 - ロシュ・アプライド・サイエンス

image

Contents

1. 111 NIIKA a S Trr ty
2. B 2 DIG
3. 4 a 2 6 3 3 3 3 1
4. 2 1 2 1 DNA 105 3 3 2
5. B 171 Part 2 PCR eS RNA 3 RN
6. 75 2 5 8 3 2 4 RNA gt RNA SS
7. 6 2kb 300 1500 bp 800 bp PCR
8. 3 3 2 25 ng ml
9. Lumi Hight s Western Blotting Substrate 1 5 0 pg 12 Lumi Light s LumiLight s Western Blotting Substrate LumiLLightPe Western Blotting Kit Mouse Rabbit
10. DIG KC 70 4 1 3
11. DIG DIG DIG DIG DNA RNA DIG
12. 300ng DNA 1 1zg DNA DNA 1 9 PCR 100 200ng 100pmol 100pmol 0 10 0 03 pg DNA in situ 0 10 0 03 pg DNA 0 10 0 03 pg RNA 10pg DNA 1 pg DNA RT
13. 124 2 3 2 30 9 DIG DIG
14. 5 kb 20 x SSC 10 20 x SSC 20 30 RNase 20 x SSC NY 2 RNase DNA RNA 20 x SSC
15. 2 1 1 2 DNA DNA DNA
16. RNA 65 10 10 97 NISA 4 FE tJ DIG MA NIIKA lt B 1 1 9
17. 5 X lg Lumi Film Kodak XAR DuPont Cronex 4 CSPD CDP S ar 1 1 2 4C 6 2 NaOH
18. 168 B DIG 11 Dr B Hengerer Ciba Geigy Switzerland C 44 84 164 244 T HHIIIITTHH HCI gt 5 kb DNA gt 5 kb 0 25 M HC1 10 20
19. MOPS 65 10 RNA RNase 100V 10
20. 112 CSPD SSC SP6 T3 T7 DIG AP 2 DIG AP 30 X 4 1 2 1
21. 1 100 Nitro Block
22. 5 e 1 10000 CDP Star 1 20000 181 C DIG
23. 8 7 2 122 5 NBT BCIP ds HzO 1 0 2 M NaOH 0 1 SDS 37 15 x 2 23 2xSSC 5 2 x SSC
24. 15 25 20 ml 2 2 5 2 1 2 10 ml 30 830 10 ml 30 30 10 ml 15 x 2 30 DIG
25. DNA DNA break break 45 2 2 5 to NIISA 4 I 8 cd to DIG DMA4 46
26. 1 20 000 CDP Star 1 100 1 200 1 500 108 2 108 2 29 D G
27. PCR 2 85 PCR DIG dUTF PCR DIG 5 1 7 1 DIG
28. tJ 4 1 3 DNA DNA 5 9 DNA 10 9 DNA 1ng DNA 10 g DNA 2 ng RNA 1 RNA 1 g mRNA 100ng DNA RNA 5 g mRNA 500 ng
29. 1 0 2 5 5 0 g 3 DIG DNA DNA DNA lt 1ng RNA RNA 1 g DIG RNA mRNA 100ng RNA 5 g DIG DNA mRNA 500 ng 4 2 1 1
30. 2 DIG DIG DIG RNA PCR DIG DIG DIG DIG 3 5 DNA DIG mm 5 NHz DIG DIG DIG DIG LdUTP FaUT LadUTP NHz DNA
31. RNase 200 8 RNase AWAY DMDC DEPC break 65 JUINN 3 S TT tJ DIG
32. 0 45 um 3 25 ng ml 0 5x 12 5 ng ml 1 5x 37 5 ng ml 37 5 ng ml 509
33. 3 2 2 4 DIG Easy Hyb 100 DIG RNA JINN 4 3 2 82 4 DIG RNA RNA 3 2 2 3 10 6 DIG RNA 77p RNA
34. 23 6 2 1 DNA 1 0
35. M 1 2 3 4 7 PCR PCRH DIG 4 PCH 1 3 DIG PCR M
36. DIG DIG DIG mRNA cDNA
37. 2 CSPD 2 37C 10 X 15 30 2
38. DIG DNA 30 40 DIG DNA 2 DIG RNA 1 2 5 2 1 DIG DNA Tip DIGC dUTP DIG 1 1 2 37C 0 2 M NaOH 0 1 SDS 15 x 2 2 3 2xSSC 5 123 sk 2 tJ JINN 4 5 2 2 NBT BCIP
39. PCR The Perkin Elmer Corporation Roche Molecular Biochemicals PCR Director of Licensing at The Perkin Elmer Corporation 850 Hincoln Center Drive Fos ter City California 94404 Roche Mo lecular Systems Inc 1145 Atlantic Avenue Alameda California 94501 2 Hoffmann La Roche Inc F Hoffmann La Roche Ltd Roche U S Patent 4 683 202 4 683 195 4 965 188 np front fee component running roy
40. DNA RNA RNA RNase DNA RNA 2 2 1 2 3 I ES 1 ml DIG RNA 100 ng DIG DNA 25 ng
41. 1 ml DIG RNA 100 ng DIG DNA 25 ng Biodyne A Pall X DIG
42. 0 1 M 0 15 M NaCl NaOH pH 7 5 20C 10 x 1 10 4 0 1 M 0 15 M NaCl pH 7 5 0 3 vv Tween 20 DIG 5 75 mU ml 10000 rpm 5 4C 12 1 104 0 1 M Tris HCI 0 1 M NaCl pH 9 5 20 1 RNase 10 X DIG Wash and Block Buffer Set Cat No 1 585 762
43. 4 REFLP 4 DIG 1 A 10 3 1 0 3 1 L 1 2 1 3 4 A RFLP 4 DIG 2 79
44. DMDC DEPC DMDC dimethyl dicarbonate DEPC diethyl pyrocarbonate 200C RNase RNase ZAP RNase 68C 42C 37C DNase 63 NIIKA 4 se PP S Tr ty NI ISA 4 24
45. NH4 pH DIG Easy Hyb 100cm2 10 2 3 15ml Tip 30 68C 30
46. RNA 3 2 2 1 RNA 2 97 yy 3 2 2 2 RNA 98 A RNA 8 B UV RNA 3 2 yy 3 2 2 3 DIG Easy Hyb 30 99 yy 3 2 2 4 DIG RNA 101 RNA _ A 6 16 B 45
47. DIG Easy Hyb 6 4 DIG Easy Hyb DNA DNA ON 12 16 173 DNA
48. DNA 172 B 2 1 K 0 45 zm Hgh Pure PCR Product Purification Kit 7
49. 4 1 105 3 3 2 71 NIISA 4 24 a 4 ee ty DIG RNA 72 3 4 DIG RNA RNA 113 4 1 4 A B DIG DIG pSPT18 Neo RNA pSPT18 Neo DNA 30 30 1 0 1 0 01 0 001 10 1 0 1 0 01 13 DNA RNA
50. 5 tJ 103 NIIKA 4 2 ty DIG DIG Easy Hyb 37C 42 DNA DNA 68C RNA RNA 50C DNA RNA GC gt 50
51. DNA High Pure Plasmid Isolation Kit Cat No 1 754 777 30 E coli DNA DNA DNA High Pure PCR Product Purification Kit Cat No 1 732 668 Cat No 1 732 676 Agarose Gel DNA Extraction Kit Cat No 1 696 505 DNA Schleicher and
52. 85 DNA 87 DNA 87 DIG Easy Hyb 89 DIG DNA DNA 90 gt 93 DIG 93 DNA DIG DNA 3 1 1
53. X B DIG 5 2 Dr Bacchetti and Dr Marusic McMaster University Canada 7
54. 5 DNA DNA ON DNA 2 4 DNA ON 12 16 3 4 6 ON RNA RNA 4 6 ON DNA 1 6 ON 1 30 2 ON 3 DIG Easy Hyb 4 6 DNA DNA 42C 37C 42 DNA RNA 50C RNA RNA 68C 1 40 GC
55. 1 7elo74GGG Telomerase Length Assay Cat No 2 209 136 http www roche applied science com 2 Telo TAGGG Telomerase Length Assay Oo AI ACE 144 3 32 7elo74GGG Telomere Length Assay TRF Immortalized cell lines 1 4
56. 0 1 mg ml A 5 g ml dA 93 NISAS 4 206 TS Trr tJ NISA 4 ty 94 3 2 RNA DIG RNA RNA RNA DNA RNA RNA RNA DNA 3 2 3 102 DIG DNA RNA
57. RNA a RNase A 100 g ml RNase A 10 mM Tris 5 mM EDTA 300 mM NaCl pH 7 5 RNase A 30 60 RNase A RNase RNase RNase A MS2 RNA 1 Es MS2 RNA MS2 RNA RNase A RNase MS2 RNA RNA
58. DIG DNA RNA RNA DNA DIG DIG DIG 2 A 156 DIG DIG
59. 47 NISA 2 SA 6 S Trr ty NIIKAS 4 a S rrTN to DIG DMA4 DIG High Prime Labeling Mix DNA ng ng 10 45 600 30 130 1050 100 270 1500 300 450 2000 1000 850 2300 3000 1350 2650 1 20 gl DNA 2 1 3 1 1 2 4 JP
60. DIG DNA RNA DNA lt 1ng 10 g DNA DNA 1 0 2 5 5 0zg 1 3 kb 3 1 10 pg 10 zg DNA RV DIG 0 1 pg 3kb 10gg 1 9 RNA RNA 1 g DIG RNA mRNA 100 ng 5ng RNA RNA 10 20 gg mRNA mRNA 1 g mRNA
61. gt gt DIG 20 x SSC tip 10
62. 9 5 CSPD CDP Sjar 5 10 CSPD CDP Star 1 11 37C CSPD CSPD CDP Sar 10 12 X 5 25 1 106 4 1 2 2 5 82 mm 132 mm 2
63. 3 1 2 3 Whatman 3 MM 4C 3 1 2 3 DIG Easy HyD 3 1 2 3 3 1 2 4 DNA 4 4
64. Lumi Light Western Blot Sub strate Lumi LightPws 10 50pg Lumi Light 3 Lumi Light ws Western Blotting Kit 2015218 lgG Mouse Rabbit lgG Lumi Light us Western Blotting Substrate 139 A 5 A 3 Lumi Light us Western Blotting 2 015 196
65. DIG HighPrime DNA Labeling and Detection Starter Kits 1 Cat No 1745 832 and Cat No 1 585614 RNA DIG Northern Starter Kit Cat No 2039 672 3 DIG Oligonucleotide 3 End Labeling Kit nd genera tion Cat No 3 353 575 3 DIG OIigonucleotide Tailing Kit nd generation Cat No 3 353 583 12 4 10 insitu 1 RNA RNA DNA DIG RNA in situ
66. lt 100 bp PIN DNA 10 100pg 10pg DNA 1 50ng 10ng 0 10 0 03 pg DNA in situ DIG dUTP gt 1kb DIG PCR DIG Labeling Mix DIG dUTP dTTP 1 20 DIG d UTP dTTP 1 3 Et 51 2 AiG 13 11 D G DIG DIG
67. 4 2 4 Tip 0 1 zg9 ml A 5zg ml dA 179 C DIG 4 3 Tip RNase RNA Rr RNA
68. 7C DIG PCR RNA 3 3 1 DIG PCR PCR DIG Probe Synthesis Kit Cat No 1636 090
69. DNA 11 PCR DIG Probe Synthesis Kit Expand High Fidelity GC MgCls 1 5 mM MgCb DNA DIG dUTP 50 PCR DIG Probe Synthesis Mix 2 5 0 07 mM GC
70. 2 1 las img DIG Tween 20 SDS FF
71. DNA 0 3 pg 0 1 pg DIG 2 2 1 1 17 PCE 18 3 2 PCR PCR
72. 6 1 DIG DIG DNA 25 ng ml PCR DNA 1 ml 2 PCR RHNA 20 100 ng ml 1 10 pmol ml 0 1 10 pmol ml 1 0 1 mg ml A 5 g ml dA A dA 6 2
73. DNA DIG dUTP DNA DIG dUTP dTTP DIG DIG dUTP dTTP K 0 1 K 20 mg ml 37C 2
74. RNA Whatman Whatman 20x SSC DNA 10 x SSC
75. Whatman 3 MM 2 200 500g 88 3 1 2 2 6 98 DIG RNA RNA RNase 20 x SSC 6 RNase ON RNA 83 2
76. DNA HE ws DIG Easy Hyb Cat No 1 603 558 DIG Easy Hyb Cat No 1 796 895 1 Cat No 1 666 649 50 25 x 24 cm 0 1 SDS 2 x SSC NY R 0 1 SDS 0 5 x SSC 9 3 1 2 1 DNA 30 2 87 yy 3 1 2 2 MA 87 A DNA 1 m B DNA C UV 3
77. 5 1 DIG SN signal to noise ratio DIG
78. DNA High Pure Viral Nucleic Acid Kit 1 193 DNA PCR PCHR Mg 6 PCR PCR 2 ty 54 DIG PCR DM4 1 5
79. 4 1 4 1 1 2 3 4 5 1 2 3 4 5 15 DIG RNA mRNA 2 1 mRNA 2 100 ng 3 50 ng 4 5ng 5 1 ng DIG RNA 1 1 2 mRNA RNA DIG 3 4 CTF1 mRNA RNA DIG X 15 TE Lik mm 16 NGF mRNA RNA
80. 1 DIG 1 36 2 DIG 3 77p DIG DIG 1 yy 2 2 1 2 5 DNA RNA
81. 2 87 3 1 2 2 DNA 2 98 3 2 2 2 RNA DNA
82. Fragile X Fragile X DNA Fragile X DNA 1 kk Fragile X 1 Fragile X 1 Fragile X 1 2 1 32P B 1 PCR DIG Probe Synthesis Kit DIG A
83. PCR F DNA Hr Roche Agarose Gel DNA Extraction Kit Schleicher and Schuell Elutips 174 C DIG gl DNA 1 A 33 gg
84. DIG Wash and Block Buffer Set Cat No 1 585 762 DIG Easy Hyb Cat No 1 603 558 Cat No 1 796 895 Nylon Membranes Cat No 1 209 299 10 x 15 cm Cat No 1 209 272 20 x 30 cm Cat No 1 417 240 0 3 x 3 m Nylon Membranes for Colony Plaque Hybridization Cat No 1 699 075 82 mm Cat No 1 699 083 132 mm Hybridization Bags Cat No 1 666 649 25 x 24 cm DNA Molecular Weight Markers DIG labeled Cat No 1 218 590 DNA MWM IL DIG labeled Cat No 1 218 603 DNA MWM Ill DIG labeled Cat No 1 669 931 DNA MWM V DIG labeled Cat No 1 218 611 DNA MWM VI DIG labeled Cat No 1 669 940 DNA MWM VII DIG labeled Cat No 1 449 451 DNA MWM VIII DIG labeled RNA Molecular Weight Markers DIG Ilabeled Cat No 1 526 529 RNA MWM 1 DIG labeled Cat No 1 526 537 RNA MWM II DIG labeled Cat No 1 373 099 RNA MWM II DIG labeled Lumi Film Cat No 1 666 657 20 3 x 25 4 cm Cat No 1 666 711 35 x 43 cm 38 1 2 1 2 2 3 2 4 2 5 3 1 3 2 3 3 4 1 4 di Sn IT ooo 40 DIG
85. JINN 4 5 gt 22 DIG DNA gt 123 NBT BCIP DIG DNA 124 DIG RNA 124 gt 125 5 1 DIG DNA
86. RNA 2 PFGE Molecular Cloning A Laboratory Manual Sambrook Fritsch and Maniatis 5 DIG C 3
87. 3 transparency technique 6 12 2 4 2 X SSC 122 5 133 DIG DIG JUINN 4 6 1 2 4 DNA 6 1 2 3 1 5 133 6 1 2 3 93 100 6
88. 1018 bp 1 ml 2 2 3 4 57 YUINN 4 5 ty DIG PCR DNA lt 2 2 2 3 PCR gt 61 2 2 4 gt 84
89. 2 3 DIG 6 16 3 1 2 3 1 6 16 Tip
90. DNA 2 MASODEZEN OO DIG DIG 2 11 3 16 4 19 5 21 6 23 7 28 gt 8 29 9 31 10 33 gt 11 36 DIG DIG
91. 83 NISAS 4 I 5 ES tJ NISAS 4 ty DIG DNA 84 3 DIG 2 1 DNA 3 1 84 RNA 3 2 94 3 3 103 3 1 DNA
92. 4 1 2 1 108 A 35 B DIG 30 C 30 D 10 45 DIG 107 0 4 1 2 1 0 1 M 0 15 M NaCl NaOH
93. 72 2 3 4 94 3 2 RNA 126 6 1 DIG 20 C 70C 20C 70 1 69 NISAS 3 S TT tJ DIG MA4 NI ISA 4 i 3 3 3 3 1 RNA
94. I pe tJ 2 3 Tj 159 A T 409 GC DNA DIG Easy Hyb T 42 Tj 80 100 80 Tryp 19 Tj 1 4C DIG Easy Hyb 2 3 100 cm2 10 cm x 10
95. 0 10 CSPD 37 10 CDP Star 9 5 25 5 lt 20 Lumi Film X 15 25 9 7p 2 109 NIIKA a A S Trr ty 4 1 2 cl
96. 65 0 4 M NaOH DNA NaOH NaOH 2 x SSC 182 D D 1 DNA RNA DNA DNA PCR RNA
97. 82 mm 0 5 ml K 132 mm 1 0 ml K 37C 1 Whatman 3MM 1 Whatman 3MM Whatman 3MM Whatman 3MM Whatman 3MM 6 1 2 2 131 JINN 4 I
98. 1 2 80 50 160 x 2 5 SDS 2 50 mM Tris HCI pH 7 5 3 2x SSC 5 124 5 2 4 DIG gt DIG 68C 10 gt 2xSSC
99. 113 4 1 4 122 5 gt 122 5 4 1 3 2 2 5 2 2 2 2 2 PCR DIG 2 1 2 3
100. DNA DNA High Pure PCR Product Purification Kit Cat No 1 732 668 1 732 676 50 2 1 3 3 1 DNA
101. RNA DMDC DEPC 10 2 DIG High Prime Starter Kit ll DIG Northern Starter Kit 76 2 5 82 1 DNA 300 ng DIG High Prime 1 450 ng DNA 450 ng 22 gl 20 ng 1 9g 20g
102. 68 15 x 2 RNA 80 3 2 2 5 gt 106 4 RNA 103 3 3 ty DIG RNA gt 113 4 1 4
103. B 171 gt 84 3 1 DNA DNA gt 126 6 1 DIG 20 Tip 20 1
104. Perkin Elmer PCR PCR Director of Licensing at The Perkin Elmer Corporation 850 Lincoln Center Drive Foster City California 94404 Roche Molecular Systems Inc 1145 Atlantic Avenue Alameda California 94501 Roche Expand SuRE Cut High Pure Titan Lumi Imager TriPure Quick Spin Atlas CLONTECH Laboratories Inc CDP Star Tropix Inc Coomassie Imperial Chemical Industries Ltd CSPD Nitro Block
105. RNA 11 5 kb mRNA 20 x SSC 15 x 2 30 15 Whatman 3MM 1 20 x SSC 20 x SSC 20 lt SSC Whatman 3 MM
106. 163 B DIG 7 4 XX 3
107. 1 ml PCR 2 zl 4 DIG D G 4 1
108. 1 ml 25 ng 2 PCR 10 50 5 DIG Easy Hyb 100 cm2 3 5 ml 90 DIG DNA
109. 86 DIG DNA 3 1 1 DNA TBE DNA DNA DNA 1 2 5 54zdg DNA DNA DN
110. ere 168 0 168 Ennead 169 18 FRNA 22 EE 0 169 13 49 171 C DIG 174 vos issosseors essere ereeeneee 183 E DIG 188 DIG 1 DIG DIG A 156 DIG B 162 DIG Cc 174 gt D 183 DIG E 188 A DIG 1 DIG 1
111. DIG DIG tPA 8 3 29 25 5 MgClz 5 5 5 1 x4 PCR 10 x 3 PCR DIG 5 5 gl 200 gM 10 x dNTPs 2 dNTP 5 Il 200 gM 10 x dNTPs 4 5 5 6 0 1 1gM Expand High 0 75 0 75 gl 0 75 gl 2 6 Fidelity 1 DNA 5 5 DNA 10 no DNA 10 pg 50 gl 50 gl 50 1 DNA 2
112. 10 15 ml DIG Easy Hyb 3 5 ml DIG Easy Hyb 2 DIG Easy Hyb 2 3 68 Tip RNA RNA DIG Easy Hyb 68 RNA 2 2 Cat No 1 666 649 2 3
113. DIG DIG DIG PCR FF DNA CsCI PCR PCHR
114. High Pure Plasmid Isolation Kit Cat No 1754 777 DIG dUTP dTTP 1 3 lt 1kb 1 3 1 6 1 3kb 1 6 1 10 gt 3kb DNA DNA DIG PCR 0 10 0 03 pg DNA 0 10 0 03 pg DNA BN 1 9 DNA 100 200 ng
115. 10 cm x 10 cm 100 cm 0 1M 0 15 M NaCl NaOH pH 7 5 10 x 1 10 0 1 M 0 15 M NaCl pH 7 5 0 3 vv Tween 20 AP 10000 rpm 5
116. 10 ml 2 5 2 5 DNA 1 0 1 ml 4 ready to use CSPD CDP Star 5 5 5 10 CSPD
117. Washing Buffer 2 1x Blocking Solution 30 DIG DIG 30 1x 1 10 000 Washing Buffer 2x15 2 Detection Buffer 2 Ready to use CSPD CDP Sjagr 5 Ready to use CSPD CDP Sjagr 10 CSPD 5 25 X 6 0 CDP Stan 5 CSPD 1 2 76 2 6 2 NBT BCIP
118. DIG DIG DIG DIG DIG http www roche applied science com DIG Tip 5 DIG DIG 41 DNA
119. 200 g 20 x 20 cm 500 g 3 5 UV 80 2 120 30 UV UV Stratalinker 4 RNase RNA
120. 1 10 DIG Wash and Block Buffer Set Cat No 1 585 762 DIG High Prime Labeling and Detection Starter Kit II Cat No 1 585 641 DIG Northern Starter Kit Cat No 2 039 672 10 x 1 10 1x 1 10 1 DIG Wash and Block Buffer Set Cat No 1 585 762 10 x 1 10 1 CDP Star ready to use Cat No 2 041 677 DIG Northern Starter Kit Cat No 2 039 672
121. PCR DNA 10 ng DNA 10 pg DIG PCR MA 4 PCR DIG 12 DIG Fragile X Fragile X 1 X CGG X X fragile
122. 0 1 SDS 2x SSC 5 x2 DIG DNA DNA 0 1 SDS 0 5 x SSC 65C 15 x 2 DNA 0 1 SDS 0 1 x SSC 68C 15 x 2 co DNA RNA DNA 0 1 SDS 0 1 x SSC 68C 15 x 2 EE RNA RNA DNA 0 1 SDS 1 x SSC
123. 122 ee se 0 1 00 es ei CO ooocceeeeceeeee 123 DIG 125 DIG 126 mm NISA WF a TT ty 40 1 DIG DIG DIG
124. PCR RNA SP6 SP6 SP6 PCR DNA 4 2 em T7 5 TAATACGACTCACTATAGGG 2 5 TAATACGACTCACTATAGGA T3 5 AATTAACCCTCACTAAAGGG RNase 5 RNase Expand High Fidelity 5l 1x 10 x 1 5 mM MgCb 1 dNTP 0 2 mM dNTP 10 mM 1 300 nM 2 300 nM Expand High Fidelity
125. DNA RNA DIG 7 mRNA situ DIG DIG DIG 7 DIG DIG 2 DNA RNA
126. MOPS 1 19 10 x MOPS pH 7 0 200 mM MOPS 50 mM sodim acetate 20 mM EDTA NaOH pH 7 0 1x MOPS 2 250 Il 100 83 I 379 50 Il 10 x MOPS 50 Il 100 RNase RNase 8 10 2 59 57 DMDC DEPC 1 MOPS
127. 4 103 3 3 113 4 1 4 121 4 2 3 3 1 3 DIG DNA DNA 3 1 2 1 3 1 2 4 DIG DNA DIG DNA
128. 5 ml ME Thin walled PCR 200 DMDC DEPC RNase ZAP High Pure Nucleic Acid Purification Kits 1 DNA RNA Labeling Kit s 41 2 Agarose MP 1 444 964 SDS 1 028 693 DNA RNA Molecular Weight Marker unlabeled 2 DNA RNA Molecular Weight Marker DIG Labeled 2 Hybridization Bags 1 666 649 DIG Easy Hyb buffer ready to use RNase and DNase free 1 603 558 20 x SSC 1 666 681 Anti DIG alkaline phosphatase 1 093 274 DIG Wash and Block Buffer Set 1 585 762 Nylon Membrane Positively Charged 1 417 240 Chemiluminescent substrate CDP Star ready to use 2 041 677 CSPD ready to use 1 755 633 Lumi Film Chemiluminescent Detection Film 1 666 657 1 High Pure
129. 4 1 1 DIG Wash and Block Buffer Set DNase and RNase free Cat No 1 585 762 Cat No 1 093 274 DIG DIG High Prime DNA Labeling and Detection Starter Kit Cat No 1 585 614 DIG Northern Starter Kit Cat No 2 039 672 Heady to use CSPD Cat No 1 755 633 Ready to use CDP Star Cat No 2 041 677 DIG Northern Starter Kit Cat No 2 039 672 2 Lumi Film Chemilumi Cat No 1 666 657 1 666 916 nescent Detection Film X 4 1 2
130. DNA 134 DIG DIG 15 5 a Es 7 K
131. DIG Wash and Block Buffer Set 1 585 762 10 x DNase and RNase free 10 x 10 x 10 x AP 1 093 274 Fab DIG DIG 1 666 649 25 x 24 cm 127 NISA 4 272 tJ JINN 4 ty DIG 128 DIG
132. GC 40 50 80 100 DNA DNA Tj 37 42 6 2 3 GC To T TT 20 25 Tox A 158 6 3
133. 5 15 5 2 3 2 x SSC puddle 1 ml 132 mm 2 ml 7 1 10 4 2xSSC 10 130 DIG DIG 15 cm UV 30 5 30 DNA 5 UV
134. Mb HCI UV 0 25 M HCI 10 20 DNA 10 DNA 20 Tip HCI DNA UV UV DNA 3 2 0 5 M NaOH 1 5 M NaCl 15 x 2 DNA
135. CSPD CDP Star DIG 107 108 110 113 106 DIG High Prime DNA Labeling and Detection Starter Kit Cat No 1 585 614
136. I tJ 68C 6 16 68 616 7p 6 2 RHNase
137. PCR DIG Probe Synthesis Kit dNTP 4 DIG dUTP 2 2 3 2 ty 58 DIG PCR MA 2 3 28 PCR DIG PCR PCR DIG DIG dUTP PCR DIG dUTP DIG dUTP
138. 2 DNA RNA 100cm2 1 ml 20 30 Ready to use CSPD CDP Star I tJ 5 5
139. 119 4 2 2 4 eeecssescseeceeecessseesesecesseceseceseesecsscceseceesecesessessseceseceeseessecscssecesecceseeeseeeseesecsseceseeeeeee 120 4 2 3 ee 121 3 5 1282 5 1 ee 122 5 8 122 5 8 1 DIG DNA ee 123 5 2 8 NBT BCIP DIG DNA 124 5 8 4 DIG RNA ee 124 5 2 5 POPLPPCPPPPPCPPPPPPPPPPPLPPCPPPPPPPCPPCPLPPPLCCPLPPPPPPPCLPPPPCPCCPLPCPPCPPLLPCPLFPLPCPPLCCCPLLLLLPLPP 1 5 6 DIG 125 6 1 DIG
140. EE 1 50 5 SDS 50 mM Tris 9 1 2 6 7 RNA 1 14 DIG 10 DIG DIG D G DIG FARRR I RE DE UD 1 Vortexer 1 Microcentrifuge 1 UV
141. DNA DIG DNA DNA DIG DNA DIG 1ml PCR 2 1 DIG DIG
142. DIG 2 139 Lumi LightPus Western Blotting Kit TeloTAGGG Telomere Length Assay RNase 4 146 DIG RNA Labeling Kit SP6 T7 RNase Protection Kit CO FSS IN 5 149 DIG Gel Shift Kit DIG DNA 6 151 PCR DIG Labeling Mix
143. Tip rt PCR 5 2 Tip 2 PCR 2 3 kb 95 2 1 95C 30 1 10 60C 30 72C 40 95 30 11 30 60C 30
144. 0 5g ml EtBr 30 A IPA 500 550 bp 442 bp DIG DNA DNA B C D DIG E DNA EtBr DNA DI
145. Oct2A DIG 2 3 6 6 DIG DINA PCR DIG DIG DNA 1000 6 2 PCR DIG Labeling Mix PCR DIG Labeling 1585550 Mix 10 x 10 x pH 7 dATP 2 mM dCTP 2 mM dGTP 2 mM dTTP 1 9 mM DIG 11 dUTP 0 1 mM
146. 1 8 DIG
147. 4 4 Tip gla 2 6 1 gl Em 180 C DIG 4 5 DNA 100 50 GC 0 5x SSC FP
148. 8 RNase 10 gt 3 4V cm 10 RNA 3 4V cm 2 2 RNA 0 25 0 50 g ml 15 lt 80 UV S TT to Q 3 2 2 2 RNA
149. DNA PCR DIG PCR 57 DIG 2 2 2 2 DIG 5 1 DIG Wash and Block Buffer Set DNase and RNase Cat No 1 585 762 DIG UV
150. 4 1 pg 1 3 4 171 B DIG 2 172 12 5 ng ml 25 ng ml B DIG DIG 2 A DNA DIG Easy Hyb
151. 2 1 2 2 20 e 200 300 l DNA DNA Klenow DNA DNA
152. 10 x MOPS 200 mM morpholineopropanesulfonic acid MOPS 50 mM sodium acetate 20 mM EDTA NaOH pH 7 0 1 10 RNA 500 ml 50g AG501 X8 30 20 RNA 100 25041 37 w y 83 1 10 x MOPS 50 41 2 5 10 1 100 RNase 50 gl DMDC DEPC 500 57 1 DIG Eas
153. 7jp 1 2 2 1 1 Whatman 3MM puddle 2 1
154. B 105 4 3 4 1 106 ready to use CSPD CDP Star 4 2 115 NBT BCIP ty 4 1
155. DIG DNA 193 89 mM Tris borate 2 mM EDTA pH 8 3 TBE DNA DIG 190 http www roche applied science com DNA UV UV 20x SSC 10 x SSC 2x SSC Whatman 3 MM 43 2 1 PCR 51 2 2
156. EDTA 0 2 M pH 8 0 DNA 65C DNA 37C 1 2 2 1 2 1 1 5 45 yy 2 1 2 2 1 3 47 yy 2 1 2 3 2 2 5 47 1 1
157. eee 105 4 106 4 1 ee 106 4 1 1 107 4 1 8 107 4 1 2 1 108 4 1 2 2 ecceeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee 1 10 4 1 3 PPPPPPPPPPPPPPFPPYTPPPPPPTPPPPPPPYPPPPPPPPPFPCPCPPPYPPPFYYETYTYPP 1 10 4 1 4 113 4 2 ee 115 4 2 1 116 4 2 2 11 4 8 8 1 DIG tt 117 4 2 2 8 NBT BCIP
158. DIG High Pure http www roche applied science com 2 http Www roche applied science com 35 DIG 11 DIG DIG 1 DNA RNA RNA DNA DIG Northern Starter Kit Cat No 2 039 672 DNA RNA RNA DIG RNA Labeling KitC SP6 T7 RNA DNA RNA Cat No 1 175 025
159. 1 0 M Tris HC1 pH 7 4 1 5 M NaCl 183 D 3 RNA 184 DIG Easy Hyb 1 ready to use DNase RNase DIG Easy Hyb Cat No 1 603 558 DNA DNase RNase DIG Easy Hyb Cat No 1796 895 DIG High Prime Label ing and Detection Starter Kit I II Cat No 1 745 832 1 581 641 64 ml 2 1 37 5 DIG Easy Hyb DNA
160. 35 153 a 3 gg 4 Oo AIT CE SN DIG DNA PCRDIG Probe Synthesis Kit PCR DIG Labeling Mix 154 5 35 DIG dUTP DIG PCR DIG Probe Synthesis Kit 1 3 DIG dUTP dTTP B PCR DIG Labeling Mix 1 20 DIG dUTP dTTP A 2 442 bp tPA DNA 10 5 2 5 g DIG DNA
161. DIG 1 ml DIG RNA 100 ng DIG DNA 25 ng 171 B 3 1 2 1 3 2 2 1
162. DIG CSPD Oct2A DIG 2 Nylon Membranes Positively Charged 1209 299 DIG Wash and Block Buffer Set 1585 762 1 2 E Oo NAINA 149 5 1 A DIG ddUTP 15 DNA 30 100 3 DIG
163. 45 RNA 66 75 121 43 49 50 173 Rapid DNA Ligation Kit 66 DIG E 188 31 122 64 67 163 179 RNA 98 RNA 20 97 RNA 62 70 71 72 RNA 95 185 RNA 62 62 RNA 20 97 RNase 70 180 RNase 146 RNase Protection Kit 146 RNase T1 146 rRNA 169 166 21
164. DNA 2 3 DIG Easy Hyb 100 cm 10 ml 2 3 Tip 30
165. BRNase 177 C DIG 4 1 FF DIG Easy Hyb DIG DIG 19 10 9 DNA RNA 50 g ml
166. HNPP Fluorescent Detection Set Cat No 1 758 888 ELISA HNPP 115 NISAS 4 sk to JINN DIG NBT BCIP I 5 gt 116 5 DIG 117 NBT BCIP 119
167. DNA DNA 3 1 2 1 2 DNA 10 g DNA 2ng T 10 C 1 3 1 2 3 2 2 6 3 1 2 4 RF YA RX 8 3 1 2 4 2 1 ml 1 10 pmol 3 0 1 10 pmol 2 1 6 3 1 2 4 4 1 T G C x 4C A T x 2 2
168. 0 1 pg RNA CDP Star 50 ng lt 5 DNA 0 03 pg DNA 100 ng RNA 15 mRNA RNA 1 2 X 161 B DIG 7 B DIG 1 1 A B A B X A B 162 B DIG 2
169. 0 2 M NaOH 0 1 SDS 2x SSC 0 3 M NaCI 30 mM Sodium citrate pH 7 0 NBT BCIP NBT BCIP DIG RNA 50 5 SDS 50 mM Tris HCI pH 7 5 2x SSC 0 3 M NaCI 30 mM Sodium citrate pH 7 0 122 5 2
170. 1 DIG 1 DIG 3 5 RNA RNase RNA DNA
171. 4 1 DIG RNA Labeling Kit RNase Protec RNase tion Kit A DNA SP6 T7 PCR B DIG RNA Labeling Kit SP6 T7 2 RNA DIG RNase free DNase DNA 20 DIG 2 C RNA RNA mRNA RNA D RNase Protection Kit DIG RNA 4 16 RNA E RNase T1 RNA
172. NGF mRNA mRNA 50 DIG NGF RNA 3 4 12 3 4 5 12 3 4 5 1 3 90 2 4 DIG RNA RNA 5 ng mRNA 50 ng CTF1mRNA 15 90 DIG RNA RNA mRNA
173. oes eic to ee vio lune ie 19 ee 19 ee 19 1 NG 23 DIG 23 23 HRSSERSIE 5 25 eee 4 eee 28 80 ES cnr 31 DIG ee 33 DIG ee cle 10 1 DIG
174. 80 3 1 2 4 7 60C DNA GO 50 0 1 SDS 0 1 x SSC 68C 104 DIG JUINN 4 3 3 8
175. DIG CSPD 2 5 2 DIG Wash and Block Buffer Set F X 5 20 1 DIG Gel Shift Kit 2nd generation Cat No 3 353 591 http www roche applied sciene com DIG Gel Shift Kit 2 2 4 1 RAC ESIN CE SN 150 DIG DNA 5 en 34 0ct2A
176. 1 7g ml RNA RNase free CO 3 19 20 4 2 1 RNA RNA RNase bake RNase RNase DMDC dimethyl dicarbonate
177. 100 ml 30 30 Tijp 3 ty 20 ml 30 830 100 ml 15 x 2 2x15 20 ml 3 3 4 2 2 2 118 4 2 2 2 NBT BCIP
178. 91 JINN 4 I pe tJ NISAS 4 ty DIG DNA 92 6 5 7jp DNA GO 80 100 0 5x SSC 40 0 19 SDS 100 bp 65C 100 bp 65 1 80
179. DIG DNA DNA DNA DIG 43 2 1 PCR 51 2 2 DNA 3 1 3 93 DIG DNA
180. DIG RNA A DIG DNA B RNA C DNA D RNA A eo RNA in zo RNA pg eo RNA cDNA X 16 RNA 24 DNA DIG XX C D 32P 32P pSPT18 Neo RNA pSPT18 Neo DNA 16 24 1 0 1 0 01 0 001 10 1 0 1 0 01 30 RNA DNA
181. oe DIG 3 Ne 4 DIG ee 5 CD 0 0 N 6 oii lt t 8 DIG 7C DIG DIG DIG 1 DIG
182. 19 4 2 ee 19 4 2 1 RHNA PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP 0 4 2 2 PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP 0 5 21 5 1 poo 6 ee 23 6 1 DIG emem 23 6 2 ere 23 6 2 1 ee 4 6 2 2 ee 24 6 2 3 ee 5 6 3 oo 5 6 3 1 PCCCPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPCPPPPPPPPPPPPPPPPPP
183. UV DNA 10 20 E DIG Easy Hyb 130 60 4 TRFs DIG 3 F DIG CDP Sjay 2 5 TRF XX G TRFs 30 TRF TRF
184. 7elo74CCGC 7eloTAGGG 2 7elo74GGG 2 209 136 2 Telomerase Length Assay DIG i A VEE a RZ
185. 5 2 5 1 0 RS 5 g ig ey 76 8 5 8 1 ime 77 2 5 2 2 DIG 8 3 DIG 84 3 1 DNA ee 84 3 1 1 esse 85 31 Sse a itd li 86 3 1 8 1 DNA oe 87 3 1 8 2 DNA 87 3 1 8 3 DIG Easy Hyb moment 89 3 1 8 4 DIG DNA DNA eee g0 3 1 26 5 YY YY
186. vitro 3 PCR 3 yy DIG 2 2 2 2 2 2 6 yy 2 3 6 DNA RNA O yy 2 4 CSPD CDP Sagr NBT BCIP yy 2 5 3 DIG DIG DIG DNA 2 2 1 2 45 PCR
187. 0 1 x SSC 5 4C 10 000 rpm 5
188. 10 ml 34 NBT 100 mg ml 35 BCIP 50 mg ml 2 x SSC 122 5 80C TE NBT BCIP PA ee ty wo 6 1 3 DIG Nylon Membranes for Colony and Plaque Hybridization 1 2m DNA
189. DIG jin s DIG RNA DNA 3 DIG 1 RNA RNA
190. DNA Isolation Kit for Cells and Tissue 1 814 770 Nylon Membranes Positively Charged 1 209 299 1 2 E 7elo7AGGG 1 854 666 Telomerase PCR ELISA 7elo7AGGG 2 013 789 Telomerase PCR ELISAPLUS LightCycler 3 012 344 LightCycler Telo TAGGG hTERT hTERT mRNA Quantification Kit RT PCR LightCycler 3 012 352 LightCycler 7elo7AGGG hTR RNA hTR Quantification Kit RT PCR 143 4 NESIN ES 3 1
191. sensesiscsas nairasetasns ensd oessneses iss 8 X 1 9 10 6 ee SeS eg CSS os set Ss ass eo oe 11 oo 12 rRNA eeeceeeeeeeeeseeeeeeeeeeeeeeeeeeeeee 13 ee 2 C DIG D eee E DIG eee VII DIG DIG
192. 26 DIG Easy Hyb Cat No 1 603 558 DIG Easy Hyb 50 1 0 72C 36 DIG Easy Hyb DIG Easy Hyb 50 6 3 1 3 P 10 6 10 PEG8000
193. MOPS MOPS 2 2 1xMOPS 30 RNA 1 29 141 9ml 1xMOPS 8 1 ml 379 1 5 3 0 9 2 1 1 RNA 1 g RNA 100ng mRNA DIG RNA DNA 102 3 2 3 1 5 DIG RNA
194. DIG DIG High Prime DNA 10 10 ng 10 gxg PCR DNA DNA DNA 10 pg DNA 1 50 ng PCR PCR DIG Probe Synthesis Kit Expand High Fidelity 2
195. RNA 1 20 kg 24 gl 800 ng gl 3 100 pmol 3 100 pmol 15 100 pmol 22 gl 4 5 pmol DNA 3A RNA 3B 3C 77 NISAS 4 4 2 SS em tJ NISA 4 4 Z ee ty 78 A 5 DNA DNA Dilution Buffer DNA 1 ng Il 1
196. 6 DIG 3 DIG 1 DIG cDNA DIG 6 1 126 125 NISAS 4 sk tJ DIG D7C
197. DIG High Prime 0 DIG High Prime DNA Labeling and 1 585 614 DIG High Prime Detection Starter Kit ll 5 x 1 1 DIG High DIG DNA Prime 1 2 2 3 DNA 3 DIG 4 7 CSPD ready to use 5 4 6 10 x 6 DIG Easy Hyb 7 1
198. la 1 20 ml 30 DIG Easy Hyb FE pH 4 2 FF DIG Easy Hyb 0 45 um
199. 4 1 S Trr ty 2 1 3 3 1732 676 High Pure PCR Product 9 Purification Kit Cat No 1 732 668 50 DIG C D 9
200. 2 5 2 1 3C 4 5 pmol 3 N4 2 5 2 1 3C 1 5 pmol Il 2 N3 12 82 DIG 11 1 1
201. 31 122 166 31 122 166 DIG 11 46 172 38 MOPS 20 185 mRNA 113 mRNA Isolation Kit 75 NBT BCIP 5 115 87 183 NGF mRNA 113 4 PCR 18 57 201 202 Gel mobility shift assay RNase protection assay Telomerase length assay Western blot assay Northern blot Kits for N RAS Nucleic acids See Target nucleic acids Nylon membrane for colony plaque hybridization Nylon membrane positively charged 0 Oct2A Oligonucleotide Calculation of amount Labeling Probes Sensitivity of Optimal hybridization temperature Optimizing PCR Overview of DIG labeling methods Pp PCR DIG Labeling Mix Comparison with PCR DIG Probe Synthesis Kit Sensitivity of PCR DIG Probe Synthesis Kit Comparison with PCR DIG Labeling Mix PCR labeling Critical hints about Troubleshooting for Typical result with PFGE Plaque hybridization Plasmid purification Plastic Film Tranparancy Wrap problems with Pol
202. X 4 1 2 1 8 30 12 CSPD Kodak XAR DuPont Cronex 4 110 and or EDTA
203. DNA 28s 18s RNA RNA DNA PCR 2 3 2 1B Expand High Fidelity 3 wrap around 1 kb 200 bp
204. 6 1 10 000 rpm 5 Mg 165 B DIG 7 6 6 3 TT Ruckes Institute of Virology Erlangen Germany 20 x SSC Li Yo 1 MP Sh bi
205. MWM Lumi Imager F1 Workstation TRF 1 Ag8 653 2 DNA 3 K562 4 DNA Ds w kbp 21 2 ue 8 6 m 7 4 6 1 5 1 5 0 4 9 4 2 3 6 3 5 2 7 2 071 9 1 9 TRF 3 1 7 4kb 2 3 9 kb 3 4 6 kb 1 4 10 2 kb 8 4 Oo NAINA 145 4 Oo NAINA HNase 146 4 RHNase RN
206. gr a 1 0 1 Al 2xSSC UV DNA 87 2 3 1 2 2 166 B DIG 7 Dr Bacchetti and Dr Marusic McMaster University Canada 108 2
207. 1 ml 100ng 50 RNase 5 DIG Easy Hyb 100cmz 3 5 ml gd DIG
208. 5 High Pure PCR Product Purification Kit Cat No 1 732 668 1 732 676 7 2 g RT PCR High Pure RNA lsolation Kit RNA Cat No 1 828 665 RNA cDNA PCR http Www roche applied science com PCR Nucleotide Mix dNTP 10 mM Cat No 1 581 295 Expand High Fidelity PCR PCR System Cat No 1 732 641 RNA cDNA SE 2 SP6 T7 T3 BC RW Roche Molec
209. DIG RNA 30 0 01 ng RNA RNA 16 0 1 ng DIG DNA 1 ng RNA RNA DIG RNA DIG DNA 100 DIG DNA RNA DNA DIG 30 24 DIG 600 200 60 20 6 2 0 6 0 2pg 7 14
210. 133 105 89 100 159 insertion 146 sz 4 RNA 146 146 in vitro 14 14 L Labeled probe yield of see Yield or labeled probe Labeling By PCR By randam primed method Direct Methods Of oligonucleotide Of RNA by transcription Overview Sensitivity of Template requirements Laboratory equipment for DIG labeling and detection Lifts colony plaque List of procedures Low labeling efficiency Low stringency wash Lumi Film Lumi Light Western Blotting Substrate Lumi Light Ms Western Blotting Kit Lumi Light Ms Western Blotting Substrate M Maleic Acid Buffer Magnesium ions Mapping transcriptional start sites Mapping transcriptional termination sites Maxi preps Membrane Diffuse bands on Letting dry out Missing bands on Problems with background see Background Reprobing Salt crystals on Stripping Unsuitable Methods for DIG labeling Mini preps Mock hybridization Molecular weight marker MOPS mRNA detection of rare mRNA Isolation Kit N NBT BCIP Neutralization of gels NGF mRNA Ni
211. 3 NaOH 4 RNA 909 10 mM pH 7 5 RNA NaOH 5 RNase 6 1 14 8 31 32 1 6 DIG DIG TSH 1
212. DIG DNA 19 87 20 97 122 171 84 88 16 75 2 65 DNA 48 58 93 99 RNA 69 70 122 31 122 123 Tips 31 24 28 28 29 30 29 7 74 Tailing Kit 74 19 87 97 176 19 19 103 TE 46 183 142 142 DNA 142 TeloTAGGG Telomere Length Assay 142 TeloTAGGG Telomere PCR ELISA 143 11 45 3 121 Tp DNA
213. 139 139 21 30 121 115 DNA 46 50 126 135 115 DIG 11 DNA RNA 13 mRNA RNA 74 PCR DIG Labeling Mix PCR DIG Probe Synthesis Kit 153 11 53 58 59 DIG 75 CSPD 29 PCR 56 RNA 68 197 198 D Deletions detecting Denaturation of template Denaturation solution for gels Density gradient DEPC Depurination Detection buffer Detection Of alkaline phosphatase Of bacterial colonies on a plate Of deletions Of digoxigenin Of DNA protein complexes Detection of probe target hybri
214. 2 3 PEG DIG Easy Hyb DIG DNase RNase DIG ready to use 122 5 1 PEG8000
215. 2 0 1 pg DNA 1 3 0 3 pg 2 1 2 2 B 3 B CO DIG 0 1 0 pg
216. 2 DIG dUTP 2 2 2 2 3 tPA 4 2 MgCk 5 Tip 4 DIG dUTP 2 2 3 1 1 55 DIG 2 PCR DMA4 EE ww 100 ZI
217. DNA 5 g RNA 500 ng mRNA RNA 1zg RNA 100 ng mRNA 169 B DIG 7 13 a DIG
218. RNase RNase RNase RNase ZAP DEPC DMDC DNA
219. 0 x SSC Cat No 1 666 681 3 M NaC1 0 3 M sodium citrate pH 7 0 20 SDS Cat No 1 028 693 sodium dodecyl sulfate 10 w v 0 2 0 45 m 2 x SSC 20 x SSC 1 10 0 1 SDS 10 SDS 1 100 0 5 x SSC 20 x SSC 1 40 0 1 SDS 10 SDS 1 100 dUTP DNA 0 2 M NaOH 0 1 SDS 10 SDS 1 100 2xSSC 20x SSC 1 10 3 RNA
220. 3 2 3 DIG DNA RNA DIG RNA DIG DNA RNA 3 2 2 1 3 2 2 4 RNA DNA RNA RNA 3 2 2 1 RNA 5g 3 mRNA 500 ng 50C 3 2 2 3 3 6 3 2 2 4 3 6 7 3 2 2 4 1 ml DIG DNA 1 20 50 ng
221. T 16 6 log 0 585 0 41 50 81 5 98 Top 98 25 C 73C Toyp 98 C 0 72 C 50 25 C 37 C 50 159 A DIG 4 Tm 4 GC 2 AT GC G DIG Easy Hyb C Tp 10 DIG Easy Hyb AT A 4 2x SSC 0 1 SDS 5 x2 DNA DNA 0 5x SSC 0 1 SDS 15 x2 65C RNA DNA 0 1 x SSC 0 1 SDS 15 x2 68C RNA RNA DNA 1 x SSC 3 15 x2
222. nsitu situ 36 NN 2 nsitu 5 A HzO Tris EDTA TE HPLC Elutips Schleicher and Schuell HPLC Elutips Schleicher an
223. 4 DIG 4 1 e 2 19
224. 8 DIG RNA DIG DIG DIG TSHr 1 NE 2 DIG 1 RNA 1 TSH TSHr 2 DIG 7 DIG
225. DMDC DEPC DMDC DEPC RNase 50 1 100ml 1g DMDC 1 DMDC 1 10 0 1 DMDC 30 DEPC DEPC DMDC DMDC RNA DMDC DEPC 20 x SSC 5 3 2 20 x SSC DMDC DEPC RNase D 23 VM4
226. 122 5 4 2 3 ty 120 4 2 3 1 3 4 5 1 1 MWM 2 5 1 0 0 5 0 25zg 18 buffy coat DNA N RAS DPNA buffy coat DNA PCR N RAS DIG
227. 6 200 ml 2 0 1 SDS 2 x SSC 7 20 3 5 5 10 200 ml 5
228. 108 2 4 1 XX X 164 5 1 Dr Bacchetti and Dr Marusic McMaster University Canada
229. 3 70C 1 5 1
230. 2 1 43 PCR DNA 2 2 51 RNA 2 3 62 DIG 2 4 73 2 6 75 DIG 3 84 DNA 3 1 84 RNA 3 2 94 3 3 103 4 106 4 1 106 4 2 115 5 12 DIG 6 125 DIG 6 1 126
231. 20 g tRNA 12 1 10 13 0 2 pg RNA 14 0 1 pg RNA 6 GAPDH 403 12 8 255 5 11 Lumi Imager 5 0 5 9 RNA 4 10 RHNA 1 4 7 10 RNA
232. 41 DNA 43 PCR DNA errr 51 RNA ee 6 DIG it 3 eee 75 DIG 84 DNA eine 1 RNA ee 1 iri le 106 106 7 115 122
233. DIG RNA DIG DNA 72 2 3 4 DIG RNA RNA mRNA 113 4 1 4 15 DIG RNA DNA ho RNA RNA T7 SP6 T3 RNA DNA RNA DIG UTP DNA RNA DNA 100
234. 11 D6 R7 N5 2 5 2 1 3A DNA DNA 1 ml 20 ng Il DNA 1 25 I 25ng DNA 11 D5 R6 N4 2 5 2 1 3A DNA DNA 1 ml 7ng DNA 3 75 I 25 ng DNA 11 D5 R6 N4
235. 125 176 163 164 High Pure PCR Purification Kit 46 High Pure Plasmid Isolation Kit 46 28 125 HNPP 5 89 100 164 25 25 25 89 100 165 DNA 75 84 RNA 75 84 103 104 126 DNA DNA 84 DNA RNA 102 DNA 93 RNA RNA 94 178 172 23 24 27
236. DIG DIG DIG 170 B DIG 2 DIG
237. JINN 4 6 1 DIG DIG DNA gt 126 129 DIG DNA 132 DNA 133 Transparency DNA 184
238. RNA 20 70C DIG RNA 20C 70 1 DIG RNA in vitro RNA 3 2 73 14 Tr ty 70 DIG MA 2 3 3 2 RNA
239. pH 7 5 2N 10 x 1 10 0 1 M 0 15 M NaCl pH 7 5 0 3 v v Tween 20 AP 10000 rpm 5 4C 2 AP 1 10000 75 mU ml 0 1 M Tris HCI 0 1 M NaCl pH 9 5 20C 1 10 x DIG Wash and Block Buffer Set RNA DMDC DEPC 2 DIG High Prime Starter Kit ll 4 DIG Northern
240. 1 3 DIG dUTP dTTP 3 tPA 2 5 g DNA B 1 20 DIG dUTP dTTP tPA 10 5 g 2 5 g PCR Labeling Mix 2 2 PCR DIG Probe Synthesis Kit R PIEOEIEIOE 156 BI E UI222 5550 0600 156 157 3 158 DNA DNA 159
241. 1 RNA 3 1 PCR DIG DIG 5 DIG DIG 2 75 2 5 15
242. 2 4 DNA ON 12 16 3 4 6 135 ON RNA RNA 4 6 113 ON M4A 1 6 ON 1 30 2ON 3 DIG Easy Hyb 4 6 27 D G 28 7 2 DIG
243. 4ml 1 NBT BCIP 3 7 NBT BCIP N X 10 16 8 TE 50 ml TE 5 9 115 4 2 2 82 mm 132 mm 2
244. DIG 38 DIG DIG DIG amp http www roche biochem jp DIG for Filter Hybridization II DIG DIG ee DIG RE EE ee DIG
245. 1 5 ml Whatman 3 MM 50 ml 15 ml 150 mm 0 45 um 34 DIG
246. Cat No 3 353 583 ty 1 in situ DNA mRNA 2 Roche http www roche applied science com 3 HPLC 74 DIG 5
247. DIG PCR DIG dUTP DNA DNA PCR DIG Probe Synthesis Kit 51 YINN 4 6 5 ty DIG PCR DNA 5 2 gag PCR 52
248. DIG DNA Labeling Kit Cat No 1 175 033 36 DIG 2 CDP Star ready to use Cat No 2 041 677 CSPD ready to use Cat No 1 755 633 DIG Luminescent Detection Kit Cat No 1 363 514 DIG High Prime DNA Labeling and Detection Starter Kit ll Cat No 1 585 614 DIG Northern Starter Kit Cat No 2 039 672 NBT BCIP Stock Solution Cat No 1 681 451 HNPP Solution Cat No 1 758 888 V DIG Nucleic Acid Detection Kit Colorimetric Cat No 1 175 041 DIG High Prime DNA Labeling and Detection Starter Kit I Cat No 1 745 832 37 DIG 3 Roche DIG
249. 0 2 2 4 PCR DIG ee 61 2 3 RNA ti 62 2 3 1 RNA cesseseeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee 63 oy RE 65 2 3 2 1 eessescsssecsseceeeesesesceesseeseeeeseceseeeceeseceseceseeseseeeceseeeseecesscesseecseseceseecesecessesesesesesee 66 2 3 8 8 RNA ooo 68 2 3 2 3 YY PP YY 69 2 3 2 4 69 8 3 3 eee 70 2 3 3 1 RNA ee 70 2 3 3 8 HNA oe 1 2 3 4 DIG RNA 72 2 4 DIG ooo 3 2 5
250. 1 in situ TT CE DNA DIG High Prime DIG High Prime DNA Labeling and Detection Starter Kit II 2 PCR DNA 22 51 PCR DIG Probe Synthesis Kit RNA Ea 62 DIG Northern Starter Kit DIG
251. 2 ES 2 44 tg 2 52 2 Op gt 2 63 2 3 1 DNA TE 10 mM Tris HC1 1 mM EDTA pH 8 0 25 C DNA 50 zg ml DNA TE DIG High Prime Labeling and Detection Starter Kit I II DNA 89 mM Tris borate 2 mM EDTA pH 8 3 25 0 25 MHCI 0 5 M NaOH 1 5 M NaQl 1 0 5 M Tris HCL pH 7 5 1 5 M NaCl 6
252. 4 C 4 99 DIG MA4 7 DIG Easy Hyb 64 ml 5 DMDC DEPC 37C 5 DIG Easy Hyb 2 3 100 cm2 10 cm x 10 cm
253. D A 0 45 m B High Pure PCR Product Purification Kit C D High Pure PCR Product Purification Kit 10 C D PCR DNA PCR
254. RNA 10 g RNA CTF1 mRNA mRNA RNA mRNA 5 pg NGF NGF in Wo NGF 8 DIG
255. 100fmol ll 1 4 5 pmol gl 1 45 1l 44 DNA Dilution Buffer DIG 2 5 pmol 1 25 DNA Dilution Buffer 79 NISAS 4 4 2 SS em tJ NISA 6 PP S Tr ty 80 ul DNA Dilution Buffer gl N1 N1 100 fmol gl N2 N1 7 3 3 30 fmol gl N3 N1 18 10 10 fmol gl N4 N2 18 33 3 fmol gl LL 1 1 N5 N3 18 100 1 fmol olm lMIM ow N6
256. CSPD ready to use Cat No 1 755 633 DIG High Prime Labeling and Detection Starter Kit II Cat No 1 585 641 1 NBT BCIP Cat No 1 681 451 DIG High Prime Labeling and Detection Starter Kit I Cat No 1 745 832 200 1 10 ml 2 NBT BCIP Cat No 1 697 471 10 ml 1 50 mM EDTA pH 8 0 20 D 5 5 N lauroylsarcosine N_lauroylsarcosine 10 w v 0 2 0 45 um SDS 7 SDS 50
257. DIG Starter Kit 5 0 1 pg 6 DIG DNA 10 3 1 03 0 1 0pg 1 a 2 6 2 DIG 1 zg DIG DNA CDP S7g DIG 10 DIG DNA
258. DIG MA 1 42C 1 1 15 2 DNase I RNase 6 37C 15 DNA 2 0 2 M EDTA pH 8 0 0 5 2 3 2 3 20C RNA 2 3 2 3 3 2 3
259. DIG PCR Expand High Fidelity Expand Long Template DNA RNA RNA PCR DIG 4 Fragile X 17 78 79 80 16 18 151 74 50 65 184 38 149 69 167 178 18 57 19 103 167 149
260. 1 RNA DIG HRNA 3 2 2 1 3 2 2 4 DIG DNA RNA 102 DIG DNA RNA na 96 DIG RNA 3 1 RNA RNA
261. PCR DMA DNA DNA DNA 10 100 pg 10 pg DNA 1 50 ng 10 ng PCR High Pure PCR Template Preparation Kit Cat No 1 796 828 DNA PCRH 0 1 1 MM
262. V 49 50 50 D 0 500 780 890 43 NIIKAS 4 Ts 6 ty DIG DNA 17 1 1 mw ww a DIG High Prime 1 585 606 2 5 x
263. lt 80 158 A 2 5 2 2 2 2 PCR 68 10
264. 0 5 M NaOH 1 5 M Nacl 1 5 M NaCl 1 0 M Tris HCI pH 7 4 21 C 2x SSC 0 3 M NaCI 30 mM Sodium citrate pH 7 0 20 x SSC Cat No 1 666 681 10 3MM Whatman UV DNA UV 126 DIG DIG K 3 115 887 1 25 ml 10 x DNase 3 115 828 5 ml gt 600 U ml 3 115 844 25 ml 37C K DIG DIG DNA
265. 40 138 163 164 168 164 165 163 DNA 88 177 BCIP 115 4 186 21 84 175 22 89 99 21 21 183 184 21 Critical hints about Diagram of setup Methods Weight to use Buffers for Blot transfer Hybridization C Calculation of hybridization temperature Capillary transfer CDP Star Cell debris Cellulose acetate filtration Cesium chloride Characteristics of blot membranes Checking PCR labeling Chemiluminescent Alkaline phosphatase substrate Detection results Detection technique Detection troubleshooting Peroxidase substrate Western blot substrate Choosing a blot transfer method Chromogeni
266. AP CSPD 25 mM 1 655 884 1 ml 100 x 1759 035 2x 1 ml 1 759 043 4 x 1 ml CSPD ready to use 1 755 633 2x 50ml 1x 0 25 mM CDP Star 25 mM 1 685 627 1 ml 200 500 x 1759 051 2 x 1 ml CDP Star ready to use 2 041 677 2x50ml 2 5x 0 25 mM Lumi Film Chemiluminescent 1 666 657 20 3 x 25 4 cm Detection Film 1 666 916 18 x 24 cm X 3MM Whatman AP NBT BCIP NBT 1 383 213 7092 4 100 mg ml BCIP 1 383 221 5 4 3 BCIP 50 mg ml NBT BCIP Stock Solution 1 681 451 67 DMSO v v NBT 18 75 mg ml BCIP 9 4 mg ml TE 10 mM
267. DIG 75 2 DIG e DIG Nucleic Acid Detection Kit NBT BCIP e HNPP DIG 1 188 E RNase DIG DNA 3 DIG
268. DIG DNA 1 50C 60 2 1 50 60 3 1 4 37C 0 2 M NaOH 0 1 SDS 20 x 2 2 5 2x SSC 5 1 DMF A ty 5 2 3 DIG RNA _ 24
269. 11 59 NIIKA 4 2 tJ NIISA 4 24 2 a 4 ee ty DIG PCR DNA 60 2 2 3 3 A EE 11 PCR DNA DNA PCR 2 tPA cystic fibrosis 500 ng DNA PCR DIG 50
270. 2 MA4 2 3 8 1 RNA rt SP6 T7 T3 RNA RT PCR DNA DNA PCR 1 kb 200 bp PCR 2 RNA 2 3 2 1A DNA
271. RNase DNase DIG RNA Labeling 1 175 025 DNA DNA RNA Kit SP6 T7 NTP DNase RNase SP6 T7 RNA RNase Protection 1 427 580 RNase Kit RNase T1 RNase A SDS K RNase RNA tRNA RNA DNA Anti DIG AP Fab fragments 1 093 274 Nylon Membranes Positively Charged 1 209 299 Ready to use CDP Star 2 041 677 DIG Wash and Block Buffer Set 1 585 762 1 2 E HNase
272. ll lt 16 4 ie 160 ee 160 ee 160 UE 161 B DIG 162 162 1 eco 168 ee 163 3 163 4 ee 164 5 164 6 ee 165 7 16 7 8 X orre oy 9
273. 2 RHNA 1g RNA DIG RNA A mRNA GAPDH B PR1b DIG Easy Hyb 1 ml 100 ng DIG A CDP Star 1 1 LET a 4 1 2 YY 8 X 10 C Peterha nsel University of Aachen Germa
274. 50 60 1 HzO 1 0 2 M NaOH 0 19 SDS 37C 20 x 2 23 2xSSC 5 2 x SSC 5092 2 5 SDS 50 mM Tris HCI pH 7 5 80 60 x 2 5 2xSSC 5 2 x SSC 6 1 2 1 20 0 4 M NaOH 65 NaOH
275. RNase Lumi Imager 5 RNA 1 GAPDH 5 0zg RNA 2 GAPDH 2 5g RNA 3 GAPDH 1 0zg RNA 4 GAPDH 0 5zg RNA 5 GAPDH 20 gg tRNA 6 GAPDH 1 10 7 5 0zg RNA 8 2 5g RNA 9 1 0 g RNA 10 0 5 g RNA 11
276. 1 30 2 3 1 2 4 DIG Easy Hyb 3 1 8 4 DIG DNA DNA 2 2 2 2 1 2 5 2 2 DIG Tip DNA
277. 1 DIG DIG PCR DNA 10 pg 10 100 pg 0 1 0 03 pg DNA DNA 10 ng 1 50 ng ee 10 ng 3 kg DNA 0 1 0 03 pg DNA DIG High Prime RNA DNA 1 kg 0 1 0 03 pg DNA PCR 100 200 ng 0 1 0 03 pg RNA 156 A DIG 2 0 1 2 g DNA in situ 3 100 pmol 10 pg DNA RNA 3 100 pmol 1 pg DNA RNA 1
278. 28 Lumi Film 107 Lumi Light Western Blotting Substrate 139 Lumi Light Ps Western Blotting Kit 139 Lumi Light Ms Western Blotting Substrate 139 186 165 146 146 46 168 163 169 31 122 166 31 122 166 DIG 11 46 172 38 MOPS 20 185 mRNA 113 mRNA Isolation Kit 75 NBT BCIP 5 115 87 183 NGF mRNA 113 4 PCR 18 57 201 202 Gel mobility shift assay RNase protection assay Telomerase length assay Western blot assay
279. 72 40 20 72C 7 1 3 kb 30 40 5l 2 2 2 2 4C PCR 56 DIG PCR DMA 2 2 5 2 QO 5 gl DNA TAE 30 TBE
280. DIG PCR 2 1 3 DIG dUTP dTTP 1 kb lt 1 kb GO 1 3 1 6 1kb 1 3 kb DUG dUTP dTTP 1 6 1 6 PCR DIG Probe Synthesis Mix 2 1 3 dNTP 4 DIG dUTP 3 kb DIG dUTP 1 6 1 10 3 kb PCR Expand Hi
281. DIG RNA 1 g DNA 10 20 zg RNA DIG 25 30 RNA DIG Northern Starter Kit RNA a RNA 63 66 RNA 2 68 69 69 RNA 2 70 RNA 2 71 DIG RNA gt 72 DIG
282. High Pure PCR Product Purification Kit PCR DNA A DIG Easy Hyb 1 ml 25 ng B High Pure PCR Product Purifi cation Kit O High Pure
283. High Pure Plasmid Isolation Kit Cat No 1 754 777 1 754 785 CsC1 2 2 3 RNA RNA DNA 7o DNA RNA DIG UTP RNA T7 SP6 T3 RNA DNA PCR RNA RNA DIG
284. 2 69 29 RNA 28s 18s RNA RNA RNA RNA RNA RNA MOPS 175 C DIG
285. 4 48 DIG DM4 NIIKA 4 se 1 3 2 1 3 1 DNA DNA
286. DNA 1 High Pure PCR Product Purification Kit 10 DMDC DEPC 10 mM Tris 200 250 gx gDNA ml 1 g 4 5 2 3 2 2 66 DIG MA NISAS 4 2 3 2 1B RT PCR RNA DNA High Pure RNA Isolation Kit 30 RNA dT 1 25 RNA x mer RNA 0 5 1
287. 183 184 183 184 159 21 87 177 CDP Star 29 131 171 174 22 PCR 57 29 113 106 110 139 139 21 30 121 115 DNA 46 50 126 135 115 DIG 11 DNA RNA 13 mRNA RNA 74 PCR DIG Labeling Mix PCR DIG Probe Synthesis Kit
288. 5 x SSC 0 1 N lauroylsarcosine 2 10 1 5 4 50 mM sodium phosphate pH 7 0 500 ml SDS 100 250ml 30 x SSC 83 ml 1 M sodium phosphate pH 7 0 25 ml 10 100 ml 10 N lauroylsarcosine 5 ml 35g SDS Erlenmeyer flask SDS SDS 500 ml 65 5x SSC 0 1 N lauroylsarcosine 0 02 SDS 1 10 1 10 50 5 x SSC 50
289. DNA Ao PCR Py DNA 2 5 zg 5 0 z9 CSPD 2 2 5 g A 5 0 g B DNA
290. 200 500 g 200 500 g Whatman 3 MM Whatman 3 MM 20 x SSC 20 x SSC 5 ga DNA 8 2 UV DNA 2xSSC Whatman 3 MM UV 1 3
291. 3 DNA D4 DNA DNA 12 RNA 5 RNA R7 RNA 2 5 2 1 3B RNA 800 ng 4 4 RNA R6 RNA 2 5 2 1 3B RNA 270ng l 3 RNA R5 RNA RNA 12 4 N5
292. 5 1 3 NBT BCIP 10 ml 200 AN Cat No 1 681 451 NBT BCIP NBT BCIP 10 ml NBT BCIP Cat No 1 697 471 1 1 10 ml 16 16 50 ml TE 5 5
293. 22 Oct2A 151 74 73 74 158 PCR 58 DIG 11 PCR DIG Labeling Mix 151 PCR DIG Probe Synthesis Kit 153 PCR DIG Labeling Mix 153 PCR DIG Probe Synthesis Kit 52 PCR DIG Labeliing Mix 153 PCR 202 58 59 61 PFGE 20 126 46 133 133 164 175 DIG 13 178 176 181 23 104 172 163 178 159 75 Labeling yield of see Yield of labeled probe Un
294. B DIG is A Pvull 7gg 1 NN C DIG DIG 2 DNA DNA A HeLa DNA B 5 g 2 5 g DNA Pvull 7ag 1 DIG DNA B 2 25 ng ml 2 B Pvull 7g
295. CDP Star 2 lt 1 2 2 transparency X 5 15
296. 2 4 73 Oligonucleotide 3 End Labeling Tailing Kits gt 25 75 42 DIG DNA 1 DNA DNA DNA DNA 6 Klenow DIG dUTP DIG High Prime
297. Cat No 1 209 272 20 x 30 cm Cat No 1 209 299 10 x 15 cm Cat No 1 417 240 0 3 x 3 m DNA DNA 250 mM HCI 0 5 M NaOH 1 5 M NaCI 0 5 M Tris HCI pH 7 5 1 5 M NaCIl 3 M NaCI 300 mM sodium citrate pH 7 0 Cat No 1 666 681 1 5MNaCIl 150 mM sodium citrate pH 7 0 0 3 M NaCI 30 mM sodium citrate pH 7 0 85 JINN 4 I pe tJ DIG 1 DIG High Prime DNA Labeling and Detection Starter Kit Il Cat No 1 585 614 3 1 2 _
298. X PCR DIG Fragile X DIG B DIG 61 NIIKA 4 5 ty NI ISA 4 a S Trr ty DIG RNA 62 3 RNA
299. DNA 1pg DIG DNA 1fg 1 6 1 6 3 PCR DIG Probe Synthesis Kit PCR DIG Labeling Mix PCR DIG Labeling Mix PCR PCR PCR DIG Labeling Mix DIG DIG dUTP dTTP 1 200 DIG DIG RNA
300. 3 DIG 11 dUTP dATP cDNA DIG Prime DNA Labeling and Dete ctian Starter Kit I DIG 11 dUTP DNA DIG RNA Labeling Kit SP6 T7 DIG Northern Starter Kit RNA DIG 11 UTP RNA DIG 188 DIG DNA RNA 2
301. DNA 80 30 77p DNA UV Stratalinker 120 mJ UV UV 1 UV 2 3 5 6 1 2 2 14 1 25 K K gt 600 U ml 14 22 mg ml 2 x SSC 1 10
302. PCR Director of Licensing at The Perkin Elmer Corporation 850 Lincoln Center Drive Foster City California 94404 Roche Molecular Systems Inc 1145 Atlantic Avenue Alameda California 94501 Roche Expand SuRE Cut High Pure Titan Lumi Imager TriPure Quick Spin Atlas CLONTECH Laboratories Inc CDP Star Tropix Inc Coomassie Imperial Chemical Industries Ltd CSPD Nitro Block Tropix Inc Cronex E I du Pont de Nemours and Co Elutips Schleicher amp Schuell Nonidet Shell International Petroleum Company Limited NuPAGE QuickPoint NOVEX Inc Parafilm American Can Company Pipetman Gilson Medical Elecronics RNase AWAY Molecular BioProducts Inc Sephadex Pharmacia AB Stratalinker Stratagene
303. Substrate 1 5 0 pg Lumi Light Western Blot Substrate 2015200 10 50 pg 1 Lumi LightPe Western Blotting Kit Mouse Rabbit A SDS 70C 10 A B SDS 1 200 V Novex 4 12 NuPAGE BisTris gel NP0321 Novex
304. 10 ng gl 1 800 ng l RNA 1 80 1gl 79 RNA Dilution Buffer DIG RNA 10 ng gl RNA Dilution Buffer RNA l RNA Dilution Buffer l R1 R1 10 ng gl R2 2 R1 18 1 10 1 ng l R3 2 R2 198 1 1000 10 pg gl R4 15 R3 35 1 3300 3 pg gl R5 5 R3 45 1 10 1 pg l R6 5 R4 45 1 3 3X10 0 3 pg gl R7 5 R5 45 1 105 0 1 pg gl R8 5 Re 45 1 3 3X105 0 03 pg gl R9 5 R7 45 1 106 0 01 pg gl R10 0 50 0 RNA C 5
305. 4 2 2 4 119 JINN 4 4 2 2 4 NBT BCIP gt 4 2 2 2 TE TE TE
306. A 4 Oo NAINA 148 4 RNase 1 2 3 4 5 6 7 8 9 10 11 12 13 14 wear 33 RNase GAPDH B 2 RNA T7 RNA DIG GAPDH pTRI GAPDH human Ambion 403 RNA RNase Protection Assay Kit DNA pA544 DNA 255 RNA RNA 1 ng 45C RNA RNA 0 5 5 no
307. AP Amp 50 mM EDTA 85C 30 AP AP AP Neor 1 AP 3 AP AP Te 1 5 3 Multicolor Detec tion Set 3 http roche applid science com PROD_INF MANUALS DIG_MAN dig120 136 pdf 121 NISAS 4 sk tJ
308. DIG Agarose Gel DNA Extraction Kit 1 696 505 100 DNA Isolation Kit for Cells and Tissue 1814770 400 mg 5x107 10 DNA Isolation Kit for Mammalian Blood e1667327 25 High Pure PCR Product Purification Kit 1 732 668 50 732 676 250 High Pure PCR Template Purification Kit e1796828 100 High Pure Plasmid Isolation Kit 1 754 777 50 754 785 250 High Pure Viral Nucleic Acid Kit 1858 874 100 PCR Clean Up Kit 1 696 513 100 Mini Quick Spin DNA Columns 1814419 50 Mini Quick Spin RNA Columns 1 814 427 50 High Pure RNA Isolation Kit 1 828 665 50 High Pure Viral RNA Kit 1 858 882 100 mRNA Isolation Kit 1 741 985 70ng mRNA mRNA Capture Kit 1 787 896 192 193 E DIG 194 1 Roche Diagnostics GmbH EP Patent No 0324474 Imstitute Pastenr 2 Roche Diagnostics GmbH EP Patent No 0324474 EP
309. JUINN 4 4 2 2 4 2 2 1 117 DIG A 35 B DIG 30 C 30 yy 4 2 2 2 D1 NBT BCIP 10 16 119 sk tJ 4 2 2 1 DIG
310. sp DIG sz DIG DNA 10g DNA mRNA DIG 73 NISAS 4 4 2
311. 20 ng DNA 1 20 1Il 19 DNA Dilution Buffer DIG DNA 5 ng DNA Dilution Buffer 1ng lI DNA Dilution Buffer DNA ul DNA Dilution Buffer l D1 D1 1 ng l D2 2 D1 198 1 100 10 pg D3 15 D2 35 1 330 3pg 1 D4 5 D2 45 1 1000 1 pg l D5 5 D3 45 1 3300 0 3 pg gl De 5 D4 45 1 10 0 1 pg D7 5 D5 45 1 33000 0 03 pg l Ds 5 De 45 1 105 0 01 pg gl D9 0 50 0 DNA B 5 RNA RNA Dilution Buffer RNA
312. 6 ml gla i ala 4 2 3 100 cmz 3 5 ml 100 cm 5 ml
313. DIG Dr Halley Erasmus University Rotterdam Netherlands Fragile X DNA Fragile X DIG A X CDP Star 20 Fragile X B X
314. DIG RNA Labeling Mix Cat No 1 277 073 mRNA RNA DNA DNA lt PCR DIG Oligonucleotide 3 End Labeling Kit 2nd generation Cat No 3 353 575 DIG OligonucleotideTailing Kit 2nd generation Cat No 3 353 583 DIG PCR Probe Synthesis Kit Cat No 1 636 090 DIG High Prime DNA Labeling and Detection Starter Kit II Cat No 1 585 614 gt DIG High Prime Cat No 1 585 606 PCR TEL 022 388 7385 FAX 022 388 7022 E mail oligo ngrl co jp URL http www ngrl co jp
315. YY 93 3 1 3 DIG DNA etter 93 3 8 RNA eee 94 3 2 1 et 95 3 2 2 96 3 2 2 1 RNA oo g 3 2 8 2 RNA 98 3 2 8 3 DIG Easy Hyb 99 3 2 8 4 _ DIG RNA RNA ee 101 3 BSE RE GS EL aie STE 102 3 2 3 DIG DNA RNA ee 102 3 3 ee 103 3 3 1 103 3 3 8
316. 9 10 Dr B Hengerer Ciba Geigy Switzerland 1
317. 37 10 CDP Star 9 5 25 5 lt 20 Lumi Film X 15 225 DNA 5 D6 0 1 pg RNA 5 H7 0 1 pg 4 N5 1 fmol gl 11 9 D6 R7 N5 81
318. RNase DIG Easy Hyb 1 6 SDS DIG Easy Hyb 509 RNA DNA RNA la RNA RNA RNase ready to use DIG Wash and Block Buffer Set Cat No 1 585 762 RNase RNA
319. http www roche applied science com DIG S NBT BCIP Stock Solution Cat No 1 681 451 NBT BCIP Ready to use Tablets Cat No 1 697 471 HNPP Solution insitu 5 16 2 16 HNPP Fluorescent Detection Set 1 2 3 HNPP
320. 2 0 2 M EDTA pH 8 0 65C 10 1 2 3 75 2 5
321. 5 kb 2 DNA 10 20 250 mM HCI DNA 10 DNA 20 DNA 5kb DNA 30 0 5 M NaOH 1 5 M NaCI 15 x 2 0 5 M Tris HCI pH 7 5 1 5 M NaCI 15 x 2 30 20 x SSC 10 10 87 JINN 2 206
322. MA 3 1 RNA RNA DIG Northern Starter Kit 2039672 _ 5 x 1a 5 1b 1 4 6 SP6 RNA 20 U l 2 T7 RNA 20 U l 3 T3 RNA 20 U l 4 DIG 5 DNase RNase 6 CDP Star ready to use 7 DIG RNA 8 DIG Easy Hyb 9 10 x 10 1 E 188
323. RNA 30 SDS K 15 RNase T1 2 F RNA 25 9 RNA 30 RNA 95C RNA 5 25 30 Novex 6 QuickPoint gels QP9731 QuickPoint QP9239 QuickPoint QP9732 G 20 U RNA 10 30
324. TeloTAGGG Telomerase Length Assay A DNA lsolation Kit for Cells and Tissue 2 5 DNA B DNA 5 DNA 2 2 DNA C 2 4 D DNA 5 10 DNA 15 x2 15 x2 6 16 DNA
325. DIG DIG DIG DIG Easy Hyb SDS Cat No 1 603 558 7 SDS 50 DIG Easy Hyb 5xSSC Granules Cat No 1796 895 2 0 1 w v N lauroylsarcosine 50 mM pH 7 0 1 50 5xSSC 002 0 1 w v 5 x SSC N lauroylsarcosine 0 1 w v 0 02 w v SDS N lauroylsarcosine 0 02 w v SDS 2 1 2 0 1 M 0 15 M NaCl NaOH pH 7 5 20 25 D G
326. Taq DNA nic as dU Komberg Ee DIG dNTP 2 LuTP T7SP6 RNA JSP t p DIG DIG DIG DlG TTY T DG gsDG DG es PY DIG DIG DIG DIG s AP DIG DIG CSPD s 1 CDP Star ci 2 DIG AP DIG NBT BCIP insitu D7
327. 0 4 M NaOH DNA DIG 4 69 10 2 0 2 mm 0 2 mm 20 RNase 1 21
328. D DIG DNA 2 5 DIG CDP Star 2 DIG Wash and Block Buffer Set E X 5 20 1 PCR DIG Labeling Mix Cat No 1 585 550 http www roche applied sciene com 2 2 3 1 4 1 Oo AIT CE SN 152 DIG DNA PCR DIG Labeling Mix 6 2 PCR DIG Labeling Mix DIG PCR
329. RNA 210 0 1 pg 14 RNase 10g RNA 5 EMSA DNA DNA DNA DIG Gel Shift Kit 3 353 591 2nd generation DIG ddUTP DNA
330. sg sz Non RI sz DIG DIG 1 DIG DiIG DIG
331. 102 DIG Whatman 200 g 20 x 20 cm 500 9
332. 134 DIG 135 6 1 1 YT 0 79 MP Cat No 1 444 964 1 699 075 82 mm 1699 083 132 mm
333. 163 179 RNA 98 RNA 20 97 RNA 62 70 71 72 RNA 95 185 RNA 62 62 RNA 20 97 RNase 70 180 RNase 146 RNase Protection Kit 146 RNase T1 146 rRNA 169 166 21 88 98 126 DIG 11 DNA RNA 15 12 203 204 Separation of DNA on a gel Separation of RNA on a gel Serial dilutions Single gene detection optimization of Southern blot Diagram of setup Spotting probe on membrane Stability of DIG labeled DNA probe Stop buffer Storage Of DNA probe Of membrane Of RNA probe Stripping buffer Stripping of membrane Time required Tips on Stringency Stringency washes Substrate for alkaline phospha
334. 2 ee ty DIG MA4 64 A NN RNA DIG RNALabeling Kit SP6 T7 T3 Cat No 1 175 025 Rapid DNA Ligation Kit Cat No 1635 379 E coli High Pure Plasmid E co 7 Purification Kit Cat No 1 754 777
335. 4 1 CDP Star 7 8 X ai w X 70 167 B DIG 7
336. 47 2 1 2 3 seeseeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee eee 47 TO CS TRG 48 2 1 3 ooo 49 8 1 3 1 2 1 3 8 ion 50 2 1 3 3 eine 50 2 8 PCR DNA oo 2 2 1 PCR POPPPPPPPPPETPPPFPPPPPPPPTTPPPYPT 2 2 26 1 PCR 53 8 8 8 8 eee 5 7 2 2 2 3 2 2 3 PCR ene 58 2 8 3 1 PCR ee 58 2 2 3 8 PCR ie 59 8 8 3 3
337. A Ti DIG Easy Hyb GC 50 DNA 100 Ts 42 ty 20 82 mm 1 275 ml 60 ml DIG Easy Hyb 1 122 IO 3 25 ng ml 95 100 5 5 4 1 3
338. Stratalinker 1 eo II 1 1 UV 1 1 37C 68C 1 2 PCR 1 1 1 X 2 3 1 2 1 1 PCR 2 DIG 3 X 33 DIG 200 ml 500 ml 50 ml 100 ml 500 ml 1000 ml 1 500 ml RNase 1 ml 200 100 10 10 ml
339. 46 133 133 164 175 DIG 13 178 176 181 23 104 172 163 178 159 75 Labeling yield of see Yield of labeled probe Uneven distribution of Problems with background see Background Procedures list of Proteinase K Pulse field gel electrophoresis Purification of template For PCR labeling For randam primed labeling For RNA transcriptional labeling Q Quantification Of labeled probe R Rainbow detection Random primed labeling technique Critical hints about Troubleshooting for Typical results with Rapid DNA Ligation Kit Reagents for DIG System Appendix E Reprobing membrane Reverse transcriptase Roller bottle RNA alkali treatment of RNA electrophoresis RNA labeling Critical hints about Troubleshooting for Typical results with RNA loading buffer RNA polymer
340. NBT BCIP 5 5 1 1 mRNA DNA Fast Red Fast Green Fast Blue 2 3 1 X 119 2 situ
341. RNA S N DIG RNA 1gg 0 1gg RNA RNA mRNA 1 1zg DNA 10 gg RNA RNA 1 DIG RNA in situ 41 DIG NISAS 4 DIG
342. RNA RNA PCR DIG 4 Fragile X 17 78 79 80 16 18 151 74 50 65 184 38 149 69 167 178 18 57 19 103 167 149 74 33 18 57 16 75 19 19 146 67 67 57 75 163 107 117 129 76 86 96 65 53 129 45 167 24 185 24 20 46 61 199 200 G GC content effect of Gel electrophoresis of labeled probes Gel mobility shift assay Gene rearrangement detecting Genomic libraries Glyoxal H High background High Pure PCR Purification Kit High Pure Plasmid Isolation Kit High stringency wash High volume screening techniques HNPP Hybridization bag Wrinkles in Hybridization Buffers Probe see Probe hybridization Sequence influence of Hybridization solution Amount to use Insufficient Hybridization techniques Amount of DNA probe required Amount of RNA probe required Critical hints about For colony plaque lifts For DNA probes and DNA targets For
343. SYBR Molecular Probes Inc SYPRO Texas Red Molecular Probes Inc Tween Desitin Werk Carl Kiinke GmbH 207 196 About this manual Additives to DIG System buffers Advantage of Alkaline phosphatase substrates DIG labeling methds Agarose Gel Gel DNA Extraction Kit MP Air bubble Alkali labile probes stripping Alkaline phosphatase inactivation of Alkaline phosphatase substrates Chemiluminescent Chromogenic Overview Sensitivity Amount of target nucleic acid required Analysis of PCR labeling Anti DIG Tips on Working dilution of chemiluminescent detection chromogenic detection Antisense RNA Application for DIG labeling B Background Irregular cloudy Irregular smeared grainy Nonspecific On one part of membrane Spotty Uniform high Baking DNA on membrane BCIP Blocking reagent Blocking solution Blot Membranes different types of Storage of Blot transfer Advantages of Blot transfer Amount of salt to use Buffers for Choosing a method 6 DIG 26 29 DIG 11 19 Gel DNA Extraction Kit 46 174 MP 35 130 169 179
344. 10 x 200 mM MOPS 50 mM sodium acetate 20 mM EDTA pH 7 0 0 MOPS DIG RNA DIG DIG 190 http www roche applied science com RNA 62 2 3 Cat No 1 209 272 20 x 30 cm Cat No 1 209 299 10 x 15 cm Cat No 1 417 240 0 3 x 3 m Whatman 3 MM UV RHNA UV
345. 68C 95 NISA 4 68C DIG Easy Hyb Cat No 1 796 895 DIG Northern Starter Kit Cat No 2 039 672 2 3 DIG Easy Hyb 1 Cat No 1 666 649 50 25 x 24 cm 0 1 SDS 2 x SSC NY 0 1 SDS 0 1 x SSC NT ty 3 2 2 RNase
346. DIG DNA PCR PCR 51 2 2 DIG Easy Hyb 1 603 558 Ready to uses 275 ml DIG Easy Hyp 42C 2xSSC 0 194 SDS 0 5x SSC 0 1 SDS NY UT
347. LU DIG DIG DIG 5 DIG DNA 20 25 DIG 1 0 1 pg9 DNA DIG DNA Labeling Ki 8 tJ RNA DIG RNA RNA DNA 72 13
348. PCH PCH SP6 T3 T7 RNA EDTA RNase 0 3 1 0 kb 5 RNase 1 3 DNA RNA 0 10 0 03 pg RNA DNA DIG RNA RNA 15 16 3 DIG
349. RNA RNA DIG RNA mRNA RNA 62 2 3 95 RNA 97 RNA 98 DIG Easy Hyb gt 99 DIG RNA RNA 101 gt 02 DIG DNA
350. digoxigenin DIG 1 H L EL a 3 1 DIG dUTP DIG dUTP DNA DIG DNA RNA DIG Roche Diagnstics WDIG OIigonucleotide 3 End Labe e PCR DIG Probe Synthesis Kit PCR DIG 11 dUTP DNA DIG High Prime DIG High ling Kit 3 DIG 11 ddUTP 1 DIG OUligonucleotide Tailing Kit
351. in situ PCR PCR 10 100 pg DNA 1 50 ng 10 pg DNA 10 ng DNA DNA PCR PCR PCR
352. pe ty NIIKA 4 PA ee DIG DIG 6 1 2 2 DIG DNA DIG Easy Hyb Tap TT 49 82 0 41 G C 600 L G C GC bp p T 20 25 Tgp DIG Easy Hyb
353. B DIG A 2 3 ji 2 1 3 3 1 3 2 4 4 1 4 5 5 1 5 2 6 6 1 6 2 6 3 Si et 139 PPCDCDCPCPCDCPCCCCCCCCCCCCDCCCCCCCCCCCCCCCCCOCCCOCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCLCLCL 140 142 ee 142 Tr 144 145 RBNase 146
354. DIG Oct2A Oct2A DIG Gel Shift Kit 12 59 6 DIG CSPD X 30 1 DIG Oct2A 0 8 ng 2 DIG 30 fmol 50 ng Oct2A 3 6 2 25 62 125 250
355. DNA DNA 87 2 3 1 2 2 7 12 TRNA M Block University of Ham burg Germany RNA DNA RNA DNA RNA DNA High Pure Plasmid Isola Gion Kit DNA RNA 68 2 2 3 RNA
356. H DIG 2 5 3 DIG CDP Star DIG Wash and Block Buffer Set l X 5 20 1 2 2 3 2 5 3 2 4 1 2 HRHNase RNase Protection Assay Kit Cat No 1 427 580 http www roche applied science com RNase Protection Kit 147 RNase ANgse
357. RNA RNA a 3 1 DNA DNA UV 5 kb DNA 5 kb DNA
358. gt 120 1g1 4 2 1 DIG Wash and Block Buffer Set DNase and RNase free Cat No 1 585 762 2 Cat No 1 093 274 DIG DIG High Prime DNA Labeling and Detection Starter Kit Cat No 1 585 614 DIG Northern Starter Kit Cat No 2 039 672 NBT BCIP Cat No 1 681 451 Cat No 1 697 471 115 DIG High Prime DNA Labeling and Detection Starter Kit 1 Cat No 1 745 832 0 1 M Tris HCI 0 1 M NaCl pH 9 5 20 TE 10 mM Tris 1 mM EDTA pH 8 AP 50 mM EDTA pH 8 0 116
359. 3 DNA DNA ee eee 4 ee oo oo 5 B DIG ee 1 SC CT 1 oee eess 8 ee 3 S eS eS a4 se So om ce 5 tt 6 SERRE SCENE AER TREE RE ba
360. 300 1000 3000 DIG High Prime DIG High Prime DNA DIG High Prime DNA 1 DIG High Prime 0 1 450 2000 120 850 2300 260 1350 2650 530 DIG High Prime DIG DNA 2 NN
361. DIG DIG 1 DIG DNA 3 5 178 C DIG 4 5 1 DNA RNA DIG Easy Hyb 68C 10 gt 4 2 2
362. PCR gt 53 58 PCR PCHR gt 58 PCR 5s9 60 PCR DIG cet 2 2 1 PCR PCR 2 PCR DIG Probe 1 636 090 Expand High Fidelity 1 Synthesis Kit PCR DIG 10 x 2 MgCl PCR 10 x 3 dNTP 10 x 4 tPA 5 PCR tPA 6 52 DIG
363. em tJ DIG 2 MA M4 DIG S A 3 DIG ddUTP 3 100 pmol 37C 15 10pgDNA DIG Oligonucleotide 3 End Labeling Kit 2nd gene ration Cat No 3 353 575 2 1 DIG dUTP dATP 100 pmol 37 15 1pgDNA 9 40 50 DIG Oligonucleotide Tailing Kit 2nd generation
364. 0 1 N lauroylsarcosine 0 02 SDS 2 10 1 5 187 E DIG E DIG DIG DNA Labeling Kit 1 175 033 1 40 DIG High Prime 2 e 1 585 606 160 pl 40 DIG Oligonucleotide 3 End 3 353 575 1 25 Labeling Kit 2nd generation D DIG Oligonucleotide 5 End 1 480 863 1 10 Labeling Set DIG Oligonucleotide Tailing Kit 2nd 3 353 583 1 25 generation 3 DIG RNA Labeling Kit SP6 T7 1 175 025 1 2x10 PCR DIG Probe Synthesis Kit e 1 636 090 1 25 DIG High Prime DNA Labeling and 1 745 832 1 12 24 Detection Starter Kit 15 NBT BCIP DIG High Prime DNA Labeling and 1 585 614 1 12 24 CSPD ready to Detection Starter Kit I1 5 8 DIG Northern Starter Kit 2 039 6
365. 1 94C 45 30 60 45 72C 90 4 PCR 100 200 ng 2 3 2 2 8 3 86 5 RNA 2 RNase 5 RNase DNA 20 2 3 2 1 1 g DNA 100 200 ng 4 PCR 4 l 1 x 5 x 1a 4gkgl 1 x 5 x 1b RNA 2 2 U 20 U gl SP6 RNA 2 T7 RNA 3 T3 RNA 4 60 1 DIG Northern Starter Kit 68
366. 153 11 53 58 59 DIG 75 CSPD 29 PCR 56 RNA 68 197 198 D Deletions detecting Denaturation of template Denaturation solution for gels Density gradient DEPC Depurination Detection buffer Detection Of alkaline phosphatase Of bacterial colonies on a plate Of deletions Of digoxigenin Of DNA protein complexes Detection of probe target hybrids Chemiluminescent methods Chomogenic methods Differential mobility of DNA protein complexes DIG basics Summary of DIG dUTP to dTTP ratio effects of DIG Easy Hyb Amount required for hybridization DIG Gel Shift Kit DIG High Prime Kit DIG labeled DNA probe storage of DIG labeled probe concentration of DIG labeling see Labeling DIG aboratory equipping DIG Northern Starter Kit DIG Oligonucleotide Labeling Kits Digoxigenin DIG Product Selection Guide DIG System General precautions Improving results Overview Products ordering information for Appendix E Troubleshooting DIG Tailing Kit DIG Wash and Block Buffer Set Dilution of probe Dimethylformamide Direct detection assay Overview of Evaluation of Procedure 146
367. A C 25 V PVDF 1 216 PVDF Western Blotting Cat No 3 010 031 NuPAGE Transfer Buffer NP0006 D TBS Tris buffered saline 2 x2 19 1 2 TBST 2 2 x4 140 E 1 2 TBST 3
368. DNA gt 5 kb Hae lI 4 bp DIG DNA 2 1 82 28 DIG 1 ml 25 ng 300 ng 10 ng 3 g DNA 1
369. PPCDCDCDCDCDCDCDCDCOCDCCCCCCDCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCDCOCCCCOCCCCCCCCC 2 RINase 148 i t tm pake 1s1e 151 DIG DNA iii Fm 151 PPCPCDCPPPCPCPCDCPCCCCCCCCCPCCCCCCCCCCCDCDCDCDCCCOCCCCCCCCCDCCCCCCCCCCCCOCCCCCDCCCCCCCL 52 PCR DIG Labeling Mix ere ofe1 PCR DIG Probe Synthesis Kit PCR DIG Labeling Mix oe 153 7 Oo AIT TA 138 1
370. X P 5S DIG DIG DIG DIG DIG s DIG am rm AP DIG Mn ac E _ LH DIG CDP Star CSPD DIG Lu minescent Detection Kit for Nucleic Acids DIG
371. 139 X PCP 75 48 205 PCR 206 PCRH PCR License Disclaimers 1 Hoffmann La Roche Inc F Hoffmann La Roche Ltd Roche PCR PCR PCR The Perkin Elmer Corporation Roche Molecular Biochemicals PCR Director of Licensing at The Perkin Elmer Corpora
372. 2 2 2 2 53 1 RNA In vitro 2 2 3 2 65 3 2 2 4 73 2 2 4 73 2 2 5 2 75 2 2 2 2 2 57 2 3 1 2 87 DNA 2 3 1 2 87 2 3 2 2 98 RNA 2 3 2 2 98 2 6 1 2 129 cDNA 2 6 2 2 145 cDNA 2 6 2 2 146 In situ 1 2 4 1 2 107 NBT BCIP 2 4 2 2 2 119 F DNA 2 5 2 1 123 DNA 2 5 2 2 124
373. 2xSSC 2 120C 30 80C 2 1 DNA UV Stratalinker 120 mJ UV UV UV 1 UV 2 3 5 2 20 XSSC 88 DIG DNA
374. DEPC diethyl pyrocarbonate RNase RNase RNase RNase 4 6 PFGE DNA PFGE DIG RNA
375. DIG DNA 15 X2 DIG 3 3 DNA iP pH pH DNA pH pH gt 9 pH 176 C DIG 3 4
376. UV 10 x 10 x 10 x 10 x DNA Dilution Buffer 50 zg ml DNA TE 10 mM Tris HCI 1 mM EDTA 25C pH 8 0 2 RNA Dilution Buffer DMDC DEPC 20 xSSC 5 3 2 DIG DNA 5 ng Cat No 1 585 738 DIG RNA 10 ng Cat No 1 498 045 3 DIG3 2 5 pmol gl DIG 2 5 pmol ILDIG Oligonucleotide Tailing Kit 7 Fab Cat No 1 093 274 3 Ready to use CSPD Cat No 1 755 633 Ready to use CDP Sja Cat No 2 041 677 3 Cat No 1 209 272 20 x 30 cm Cat No 1 209 299 10 x 15 cm Cat No 1 417 240 0 3 x3 m 1 DIG Hi
377. 0 75 2 6 U cDNA 2 2 50 l 1 Expand High Fidelity 5kp 1 67 DIG 2 MA4 5 5 100 Il PP PCR 50 94C 2
378. 13 DIG PCR MA 14 2 2 2 PCR 2 2 1 6 DIG dUTP DNA 20 25 1 DIG 0 10 0 03 pg DNA DIG DIG DIG
379. 2 DNA h 4 3 1 2 3 DIG Easy Hyb 30 89 h 4 3 1 2 4 DIG DNA 90 DNA 4 A 4 16 B 45 1 DNA DIG DNA 3 1 2 1 3 1 2 4 DIG DNA 93 DIG DNA
380. 2 2 B DIG 15 DNA Oct2A DNA d A T d I C DNA C 0 5 x TBE 50 60 70 V Novex 5 x High Density TBE Sample Buffer LC6678 6 DNA Retardation Gel EC6365 XCell ll Mini Cell E19001 D 0 5 x TBE 30 V 1 Novex XCell II Blot Module E19051 A 4 E DIG DNA
381. 200 bp lt 1000 bp 1 kb DNA 1 9g PORH 100 200 ng EDTA 0 2 M pH 8 0 _ 2 3 2 RNA 2 3 2 1 66 A 3 2 B RHT PCR 2 5 yy 2 3 2 2 80 68 yy 2 3 2 3 2 2 5 69
382. E 188 DNA 100 bp DNA DNA 10 ng 3 g DNA 300 ng 44 DIG DM4 DNA
383. PCR 2 2 DNA DNA 2 kb 300 1500 bp 800 bp S Tr ty 49 DIG DMA4 NIIKAS 4 3 1 3 8
384. UV RNA 2x SSC Whatman 3 MM UV 1 3 2xSSC 2 2 120C 30 80C 2 1 RNA UV Stratalinker 120 mJ UV UV UV 1 UV 2 3 5 2 20 Xx SS
385. ee ee ee 1 1 EC DE SE EE SR a 10 DIG 2 DIG oo 11 2 1 DIG ee 1 1 2a 28 PCH RNA mt 13 2 2 1 PCR PCCPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP 13 CPPPCPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP 14 2 2 3 RNA 14 2 2 4 3 15 3 16 3 1 l 16 3 2 PCR 18 4 19 4 1
386. gt 102 RNA JINN 4 3 2 1 DMDC DEPC 200 RNase RNase ZAP RHNase 20 x SSC 3 MNaCI 300 mM sodium citrate pH 7 0 I pe Cat No 1 666 681 RNA 192 tJ MOPS
387. 141 2 4 NESIN SN 4 Oo AIT CE SN 142 10 1 100 10 1 100 10 hg hg ng ng 31 Lumi LightPes Western Blotting Kit Mouse Rabbit ready to use Novex NuPAGE 4 129 PVDF Western Bloting Lumi Light te Western Blotting Kit Mouse Rabbit WW 1 0 1 ng pg pg pg pg
388. 2 DIG DNA 25 ng ml DIG DNA DIG Easy Hyb 6ml 4 20 25 ng ml DIG DNA DIG Easy Hyb 10 15 ml 5 2x SSC 0 1 SDS 5 x 2 2 6 0 5x SSC 0 1 SDS 15 x 68C 2 E coli DNA 2 68C 0 1 x SSC 0 1 SDS 1 84 3 1 132 DIG DIG 6 1 3 DNA
389. 3 1 DNA 2 DNA 126 6 1 DIG 20 Tip 20 1 2 2 3 PCHR ee 2 2 3 1 PCR PCR DIG DIG dUTP PCR
390. 4 se PP S Tr ty DIG PCA DMA NI ISA 4 2 2 2 1 PCR 10 ng PCR DIG Probe DNA 10 pg DNA Synthesis Kit 650cms 20 30 DNA buffy coat High Pure PCR Template Preparation Kit 24 2 2 ee DNA DNA High Pure Plasmid Isolation Kit
391. DIG 600 0 2 pg RNA MOPS 3 2 DIG RNA DIG Easy Hyb 1 ml 100 ng 65C CSPD X 35 M Block University of Hamburg Ger many 0 2 pg RNA 4 DIG
392. RNA DIG DNA RNA mRNA sz DIG PCR VA 2 2 4 3 PCR 10 pg DNA ee 10ng DNA 2 SSOODE1G 2 mini preps maxi preps 300 ng 1gg DNA
393. 0 1 SDS 2 x SSC 5 10 200 ml 5 5 0 1 SDS 0 1 x SSC 68 101 DIG NMA ET 30
394. 50 ng RNA mRNA CTF1 mRNA DNA BRNA 5g mRNA 500 ng RNA mRNA 157 A DIG 3 3 DIG DNA 25 ng ml PCR DNA 2l ml RNA 20 100 ng ml 1 10 pmol ml 0 1 10 pmol ml 1 0 1 mg ml A 5 g ml dA
395. DIG Easy Hb 50 158 A DIG 3 DNA DNA Ti Tj DIG Easy Hyb DIG Easy Hyb 1 2 1 DIG Easy Hyb DIG Easy Hyb DNA DNA Trwyp T 49 82 0 41 G C 600 L Ts Ta 20 25
396. T G C G C Top DIG Easy Hyb GC 40 80 100 80 Ti 1 1 4 L bp 7 G C 50 72 bp DIG Easy Hyb T 49 82 0 41 50 600 72 62 C DIG Easy Hyb Ty 62 20 25 42 37 DIG Easy Hyb 6 DIG Easy Hyb DIG Easy Hyb DNA DNA Tj T 16 6 1og Mol Nat 0 41 6 G C
397. mi 126 6 1 1 PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP 126 6 1 2 129 6 1 8 1 oe 129 6 1 8 2 DIG DNA ee 132 6 1 2 3 DNA 133 6 1 8 4 DNA omment 134 6 1 3 ee 134 6 1 4 DIG YY 135 1 CD ER NR 138 a ee 139 2 1 ee 140 2 2 142 3 ee 142 3 1 POPPCPPPPPLPPPPPP
398. 2 x4 F IgG lgGZ 1 400 30 2 TBST 2 x4 G Lumi Light us Western Blotting Substrate 5 1 1 2 POD Lumi Light LUS POD CS 10 20 X 3 1 Lumi LightPs Western Blotting Kit Mouse Rabbit Cat No 2 015 218 http Www roche applied science Ccom 2 Lumi LightPte Western Blotting Kit Mouse Rabbit
399. 21 183 184 21 Critical hints about Diagram of setup Methods Weight to use Buffers for Blot transfer Hybridization C Calculation of hybridization temperature Capillary transfer CDP Star Cell debris Cellulose acetate filtration Cesium chloride Characteristics of blot membranes Checking PCR labeling Chemiluminescent Alkaline phosphatase substrate Detection results Detection technique Detection troubleshooting Peroxidase substrate Western blot substrate Choosing a blot transfer method Chromogenic Alkaline phosphatase substrate Detection results Detection tequnique Chromosomal DNA interference of Cleaning dirty probes Colony hybridization Typical results with Color substrate Comments on DIG abeling methods Comparison of DNA and RNA probes mRNA and total RNA probes PCR DIG Labeling Mix and PCR DIG Probe Synthesis Kit Popular labeling methods Concentration of template Controls DIG labeled CSPD Cycler settings for PCR labeling Production of RNA abeling template 103 88 21 88
400. 9 2 1 g DNA 7 100 200 ng PCHR EDTA EDTA 0 1 mM EDTA 3 DNA RNase
401. Bastian Hengerer Ciba Geigy Switzerland 0 6 pg mRNA NGF mRNA 113 JUINN 4 sk 2 tJ JINN 4 gg ty 114 i hed 4 het 3 1 B 17 2 1 2 1
402. RNA 2 5 2 3 124 B 2 172 mew o B 1 162 C 174 1 Nonradioactive In Situ Hybridization Application Manual Non RI situ 1 1 DIG 8 2 1 2 2 3 1 3 2 4 1 4 6 1 6 2 ee 6 4 10 11 O ii 6 DIG rt 1 1 DIG eee 11 PCR RNA 13 EEEEEEE EE 16 oo 16 PCR ee 18
403. Roche Applied Science DIG for Filter Hybridization 0 DIG http www roche applied Science com DIG Home Ee I Ree At Your Service Industry What s New Online Ordering Support Printed Materials ContactUs Roche Diagnostics productsearch a DIG Reagents and Kits for Go H 1 H Non Radioactive Nucleic Re Acid Labeling and Detection Integrated Solutions Genomics Systerns MagNA Pure LC Systems The enormous advances in molecular biology are inconceivable without the use of LightCycler System labeled nucleic acids Far many years it was generally accepted that radioactively LightTyper System labeled probes provided the highest level of sensitivity in detection of single copy PH genes or rare InRNAs However in recent years non radioactive labeling systems like NS logy the DIG system by Roche Applied Science have become mare and more popular since Transfection amp they provide similar sensitivity and are much faster and more convenient to use Cellular Sciences Froteomic ecence This website presents information on the most important DIG reagents and kits available from Roche amp Applied Science and will help you to select the best product for Biochemistry Ei yaur application To explare this informatinn please follow
404. S Tr tJ NISAS 4 ty DIG DNA 15 Whatman 3 MM 1 20 xSSC 20 xSSC 20 xSSC Whatman 3 MM Whatman 3 MM 1
405. 10 ng 3z9g DNA 300 ng 16 DNA 10 10 DNA 1 DIG High Prime 4 DIG High Prime 37C 1 Tip 20 10
406. 30 29 7 74 Tailing Kit 74 19 87 97 176 19 19 103 TE 46 183 142 142 DNA 142 TeloTAGGG Telomere Length Assay 142 TeloTAGGG Telomere PCR ELISA 143 11 45 3 121 Tp DNA RNA T DNA DNA T 159 159 160 24 158 160 159 RNA 62 Transcription Vector Transfer buffer Transparancy technique TRF Troubleshooting for PCR labeling Random primed labeling RNA transcriptional labeling Two probes on same blot U Unincorporated DIG UV crosslinking V Vector sequences elimination of W Washes stringent Washing buffer Wash temperature Western blot assay nonradioactive XX X phosphate see BCIP Y Yield of labeling probe est
407. _ DNA RNA 10 ty SP6 T7 T3 1 5 Rapid DNA Ligation Kit E coli 0 16 High Pure Plasmid Isolation Kit 30 5 1 3 wrap around
408. 151 5 4 Oo NAINA DIG DNA Anti DIG AP Fab fragments 1 093 274 Nylon Membranes Positively Charged 1 209 299 Ready to use CDP Star 2 041 677 DIG Wash and Block Buffer Set 1 585 762 1 2 E 6 1 PCRDIG DNA A PCR DIG Labeling Mix PCR 2 DNA B TBE TAE 30 2 C DNA a DNA
409. 4 2 AP 1 5000 150 mU ml 117 0 1 M Tris HCI 0 1 M NaCl pH 9 5 20C TE 10 mM Tris HCI 1 mM EDTA pH 8 0 1 10 x DIG Wash and Block Buffer Set 10 RNA DMDC DEPC 2 100 ml 2 2
410. 8 X 5 2 x SSC 0 45 m Schleicher and Schuell High Pure PCR Product Purification Kit DIG RNA RNA 1 RNA 1 9 mRNA 100 ng RNA RNA mRNA mRNA
411. Tropix 10 100 DNA UV 1 DIG Easy Hyb DIG Easy Hyb 22 DIG 6 D DIG DIG 2P G
412. 20 0 3x 5cm 5 D2 D9 3A R3 R10 3B N2 N6 3C 1l D2 D9 R3 R10 N2 N6 1gI Stratalinker 120 mJ 3 5 UV 3 5 120 30 30 ES 80C 2 2 5 6 DIG
413. 47 56 183 46 DEPC 184 176 183 186 29 Lumi Imager 146 29 106 DNA 149 29 106 115 DNA 149 DIG 156 DIG 156 161 DIG dUTP dTTP 14 59 DIG Easy Hyb 26 104 158 89 100 DIG Gel Shift Kit 149 DIG High Prime Kit 44 DIG 48 58 69 DIG DIG 158 DIG 33 DIG Northern Starter Kit 63 DIG Oligonucleotide Labeling Kit 74 3 DIG 36 DIG 174 DIG 174 DIG 11 DIG
414. 5 SDS 2 x SSC 20 x SSC 1 10 185 D 4 186 4 RNA DMDC DEPC 3 RNase DIG Wash and Block Buffer Set Cat No 1 585 762 10 x 1 10 DIG Wash and Block Buffer Set Cat No 1 585 762 10 x
415. DNA 1 DIG DNA PCR DIG buffy coatDNA 0 25 zg N RAS 19 3 M13 amp M13 neor M13 tet 3 1 1 1 DIG Amp Neo Tet 3 25 ng ml Multicolor Detection Set 3 1 DIG DIG AP
416. K DIG 6 1 4 DIG 1 1 1 ss 1 re a tg LT 1 s 20 2 M13 2 1 Amp 2 Tet 2 1 1 E coli 2 DIG Easy Hyb 25 ng ml 1 Ampr DIG 2
417. NISAS 4 I 5 ES tJ NISAS 4 ty DIG 1 DNA 5 DNA D6 DNA 2 5 2 1 3A DNA 20 ng Il 4 DNA D5 DNA 2 5 2 1 3A DNA 7 ng I
418. puddle puddle PA ee ty 5 15 5 5 15 15 2 3 1 5 M NaCl 1 0 M Tris HCI pH 7 4 puddle 1 ml 132 mm 2ml Whatman 1 3MM 5 15 4
419. 135 JINN 4 I pe 22 ty NIIKA 4 PA ty DIG DIG 136 21 2000 3 P A DIG B Dr Bouchier Genethon France ss 4 2 2 18 DIG 15
420. 30 50 133 DIG 2 D2 CDP Star DIG 5 25 6 1 2 4 D3 NBT BCIP 10 16 134 DIG 6 1 1 4C 30 30 YT 0 7 MP 0 5 M NaOH 1 5 M NaCI puddle 1
421. 74 33 18 57 16 75 19 19 146 67 67 57 75 163 107 117 129 76 86 96 65 53 129 45 167 24 185 24 20 46 61 199 200 G GC content effect of Gel electrophoresis of labeled probes Gel mobility shift assay Gene rearrangement detecting Genomic libraries Glyoxal H High background High Pure PCR Purification Kit High Pure Plasmid Isolation Kit High stringency wash High volume screening techniques HNPP Hybridization bag Wrinkles in Hybridization Buffers Probe see Probe hybridization Sequence influence of Hybridization solution Amount to use Insufficient Hybridization techniques Amount of DNA probe required Amount of RNA probe required Critical hints about For colony plaque lifts For DNA probes and DNA targets For DNA probes and RNA targets For oligonucleotide probes and DNA targets For RNA probes and RNA targets Importance of sealed containers Mock Overview Temperature required Hybridization techniques Time required Transparancy techniqu Troubleshooting Use of plastic wrap Hybridization temperature Optimal Insertions detecting In situ hybridization Internal control RNA Intron exon structure of genes In vitro transcription K Klenow GC 25 18 57 149 rearrangement 146
422. 81 5 T 25 1 0 72 50 36 0 72 x 50 MolNa G C G C Tp 80 100 20 80 Tj 1 1 4 Ti 3 xSSC Mol Nar 0 585 M G C 50
423. Tef CSPD 45 2 2 1 AP 50 mM EDTA A DIG AP 1 Amp B AP 2 AP 2 AP B Amp Te A B Te
424. 0 1 1gM 2 PCR _ 2 2 2 1 PC 53 4 20 30 B 4 PC C DIG dUTP 2 Dreak yy 2 2 2 2 1 57 53 YUINN
425. 0 1 SDS 3 3 88 1 100 DNA 2 3 0 5 x SSC 160 A DIG 5 5 DIG NBT BCIP 0 1 pg DNA 16 1 9 DNA 38 CSPD 50 ng lt 30 DNA 0 03 pg DNA 0 3 zg DNA
426. 3 100 cm 3 5 ml 6ml
427. 31 122 121 186 29 107 30 115 29 161 19 PCR 57 DIG 4 DIG 181 DIG 108 DIG 117 RNA 62 DIG 40 138 163 164 168 164 165 163 DNA 88 177 BCIP 115 4 186 21 84 175 22 89 99 21
428. E 188 DIG 162 DIG Tailing Kit 74 DIG Wash and Block Buffer Set 186 76 122 16 16 76 Results Serial dilutions for When to use Direct detection of DIG labeled DNA on a gel Direct labeling with DIG Dirty probes cleaning DMDC DNA molecular weight marker DNA protein complexes DNase I Dry membrane effects of E Effect of DIG labeling on mobility Electrophoresis of target nucleic acids Critical hints about Electrostatic charge EMSA End Labeling Kit Equipping a DIG laboratory Estimation of PCR labeling Estimation of probe labeling Ethidium bromide staining technique Ethidium bromide sensitivity of Exon intron structure of genes Expand High Fidelity Enzyme Blend Expand Long Template Enzyme Blend Evaluation of probe labeling F Filtration Chemiluminescent detection of probes on a blot Chromogenic detection of probes on a blot Colony hybridization Estimation of probe yield Hybridization of DNA probes to a Southern blot Hybridization of RNA probes to a Northern blot Flow chart for Labeling of RNA probes PCR labeling or probes Performing a DIG labeling and detection experiment Plaque hybridization Random primed labeling Forceps Formamide Effect on hy
429. Patent 0371262 Roche Diasnostics GmbH EP Patent No 0649909 Institute Pasteur 3 Roche Diagnostics GmbH EP Patent No 0124657 0324474 mstitute Pastenr 4 Roche Diagnostics GmbH EP Patent No 0324474 5 Roche Diagnostics GmbH EP Patent No 0124657 U S Patent No 5 344 757 6 Roche Diagnostics GmbH EP Patent No 0324474 EP Patent 0371262 U S Patent No 5 344 757 Institute Pastenr 7 Tropix Inc USA U S Patent No 5 326 882 8 EP 0497972 U S Patent No 5 112 960 Tropix Inc USA 9 Roche Diagnostics GmbH EP Patent 0371
430. Schuell Elutips DNA E coli co7 DNA Ecoli PCR DNA DNA Tris 10 mM Tris pH 7 5 EDTA TE
431. Starter Kit 5 Cat No 1 096 176 ty 108 10 cm x 10 cm 100 cm 6 9 fransparency 133 6 1 2 3 100
432. Tropix Inc Cronex E I du Pont de Nemours and Co Elutips Schleicher amp Schuell Nonidet Shell International Petroleum Company Limited NuPAGE QuickPoint NOVEX Inc Parafilm American Can Company Pipetman Gilson Medical Elecronics RNase AWAY Molecular BioProducts Inc Sephadex Pharmacia AB Stratalinker Stratagene SYBR Molecular Probes Inc SYPRO Texas Red Molecular Probes Inc Tween Desitin Werk Carl Kiinke GmbH 207
433. alty component PCR Perkin Elmer PCR
434. ml 132 mm 2 ml puddle Whatman 3MM 3 129 DIG DIG 1 2 1
435. 0 ee aw RFLP A B 3 DNA 173 C DIG C DIG DIG DIG
436. 0 5x SSC 60 40 0 1 SDS 80 100 0 1x SSC 68C 50 0 1 SDS 1 30 7 15 x2 3 1 2 5 DNA DIG DNA 106 4
437. 10 g 1g 100 ng 10 ng 1 ng 100 pg 10 pg 1 pg 0 1 pg Lumi Imager F1 Workstation 0 1 pg Lumi LightPes Western Blotting Substrate 3 DNA DNA DNA TTAGGG G
438. 262 10 Roche Diagnostics GmbH EP Patent No 0324474 EP Patent 0371262 U S Patent No 5 344 757 Roche Molecular Systems The Perkin Elmer Corporation PCR 206 2 Roche Molecular Systems The Perkin EImer Corporation 206 1 196 About this manual Additives to DIG System buffers Advantage of Alkaline phosphatase substrates DIG labeling methds Agarose Gel Gel DNA Extraction Kit MP Air bubble Alkali labile probes stripping Alkaline phosphatase inactivation of Alkaline phosphatase substrates Chemiluminescent Chromogenic Overview Sensitivity Amount of target nucleic acid required Analysis of PCR labeling AntiDIG
439. 72 6 2 2 RNA RNA gt RNA DNA gt DNA DNA 24 RNA RNA RNA DNA DNA DNA 40 GC DIG Easy Hyb 50 Topt DNA DNA 37 42C DNA RNA 50C RNA RNA 68C Tox GC
440. 72 1 10x10cm2 10 DIG DNA Labeling and Detection Kit 9 1 093 657 1 25 50 Cat No DIG Luminescent Detection Kit 1 363 514 1 50 Biotin Luminescent Detection Kit 1 811 592 1 50 DIG Nucleic Acid Detection Kit 5 1 175 041 40 188 E DIG DIG 1 093 274 Anti Digoxigenin AP Fab fragments 5 Anti Digoxigenin POD Fabfragments5 e1207733 Anti Digoxigenin POD poly 1 633 716 Fab fragments 5 BM purple 1 442 074 5 Bromo 4 chloro 3 indolyl 1 383 221 phosphate BCIP HNPP Fluorescent Detection Set 1 758 888 4 Nitroblue tetrazolium chloride NBT 1 383 213 NBT BCIP Ready to Use Tablets 697 471 NBT BCIP Stock Solution 1 681 451 CDP Star 1 685 627 759 051 CDP Star ready to use 2 2 041 677 CSPD 9 1 655 884 1 759 035 1 759 043 CSPD ready to use 5 1 755 633 150 U 200 pl 150 U 50 U 100 ml 3 ml 150 mo el 5mg HNPP 100 mg Fast Red T
441. 88 98 126 DIG 11 DNA RNA 15 12 203 204 Separation of DNA on a gel Separation of RNA on a gel Serial dilutions Single gene detection optimization of Southern blot Diagram of setup Spotting probe on membrane Stability of DIG labeled DNA probe Stop buffer Storage Of DNA probe Of membrane Of RNA probe Stripping buffer Stripping of membrane Time required Tips on Stringency Stringency washes Substrate for alkaline phosphatase Chemiluminescent Chromogenic Overview T Table of procedures Tailed oligonucleotide probe Tailing Kit Target nucleic acid Amount required on gel Concentration of Degraded Electrophoresis of Fixation to gel Too much TE buffer Telomere Telomere length assay Telomeric DNA 7elo74CGC Telomere Length Assay TeloTAGGG Telomere PCR ELISA Template Concentration Contamination in Purification see Purification of Template Three probes on same blot Tp Calculating For DNA probes For oligonucleotide probes For RNA probes T of oligonucleotides T of DNA DNA hybrid Transcriptional labeling of RNA DNA RNA
442. A RNase DIG RNA RNA RNase DNA RNA S1 RNA RNA RNA DNA RNA
443. A 75 84 103 104 126 DNA DNA 84 DNA RNA 102 DNA 93 RNA RNA 94 178 172 23 24 27 133 105 89 100 159 insertion 146 sz 4 RNA 146 146 in vitro 14 14 L Labeled probe yield of see Yield or labeled probe Labeling By PCR By randam primed method Direct Methods Of oligonucleotide Of RNA by transcription Overview Sensitivity of Template requirements Laboratory equipment for DIG labeling and detection Lifts colony plaq
444. A 1 10 zg DNA 1 lt 1 ng DNA DIG DNA DNA 5 DNA 30 2 DNA 0 25 0 50 g ml 15 30 UV 3 1 2 2 DNA 5 kb 3
445. C 3 2 2 3 Whatman 3 MM 4 3 2 2 3 DIG Easy HyD 3 2 2 3 3 2 2 4 RNA
446. DNA probes and RNA targets For oligonucleotide probes and DNA targets For RNA probes and RNA targets Importance of sealed containers Mock Overview Temperature required Hybridization techniques Time required Transparancy techniqu Troubleshooting Use of plastic wrap Hybridization temperature Optimal l Insertions detecting In situ hybridization Internal control RNA Intron exon structure of genes In vitro transcription K Klenow GC 25 18 57 149 rearrangement 146 125 176 163 164 High Pure PCR Purification Kit 46 High Pure Plasmid Isolation Kit 46 28 125 HNPP 5 89 100 164 25 25 25 89 100 165 DNA 75 84 RN
447. G 3 B E 10 1 ml 2 PCH 1 ml 0 5 1 ml 4 10 PCR PCORH DIG 3054 bp 2036 bp 1636 bp
448. G 156 161 DIG dUTP dTTP 14 59 DIG Easy Hyb 26 104 158 89 100 DIG Gel Shift Kit 149 DIG High Prime Kit 44 DIG 48 58 69 DIG DIG 158 DIG 33 DIG Northern Starter Kit 63 DIG Oligonucleotide Labeling Kit 74 3 DIG 36 DIG 174 DIG 174 DIG 11 DIG E 188 DIG 162 DIG Tailing Kit 74 DIG Wash and Block Buffer Set 186 76 122 16 16 76 Results Serial dilutions for When to use Direct detection of DIG labeled DNA on a gel Direct labeling with DIG Dirty probes cleaning DMDC DNA molecular weight marker DNA protein complexes DNase I Dry membrane effects of E Effect of DIG labeling on mobility Electrophoresis of target nucle
449. G DNA DI a rp a taq DNA TdUTP DIG UTP T7 SP6 RNA DIG DIG DIG e i i DIG DIG 4 PCR RNA 2 2 1 PCR PCR Taq DNA 100 DIG dUTP DNA PCR PCR mRNA
450. Northern blot Kits for N RAS Nucleic acids See Target nucleic acids Nylon membrane for colony plaque hybridization Nylon membrane positively charged 0 Oct2A Oligonucleotide Calculation of amount Labeling Probes Sensitivity of Optimal hybridization temperature Optimizing PCR Overview of DIG labeling methods Pp PCR DIG Labeling Mix Comparison with PCR DIG Probe Synthesis Kit Sensitivity of PCR DIG Probe Synthesis Kit Comparison with PCR DIG Labeling Mix PCR labeling Critical hints about Troubleshooting for Typical result with PFGE Plaque hybridization Plasmid purification Plastic Film Tranparancy Wrap problems with Polylinker Popular DIG labeling methods Prehybridization Pretreatment of gel before blot transfer Prewarming wash buffers Probe hybridization Concentration during hybridization Denaturation of Effects of too little Effects of too much Filtration of Homology with target Labeling estimation of 149 RNase 146 142 139 94 63 N RAS 121 126
451. PPPPPPPPPPPCPCPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPCEPPPPCEPPEPPPT 144 3 8 145 4 RNase 146 4 1 POPPPPPPPPPPPPPPPPPPPPPPPPPCPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPCPPPPPCEYEPPTI 147 4 8 RNase 148 5 ee 149 5 1 POPPPPPPPPLPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPCPPPPPPPPPCPPEPPTI 150 5 8 151 6 DIG DNA Cm 151 6 1 152 6 2 PCR DIG Labeling Mix ete 153 6 3 PCR DIG Probe Synthesis Kit PCR DIG Labeling Mix ee 153 A DIG 0 oo 1 DIG
452. PPPPPPPPPPPPPPPPPPPPPPPPPPPEPPPPPP 6 6 4 ee 27 28 8 ee 29 9 31 10 DIG errreeeeeeeerreeereeeee 33 11 DIG en 36 III IV 1 oo 40 DIG 41 8 1 DNA 43 1 1 PPPPPPPPPPPPPPPPPPPPPTPPPPPPPPPPPPFTPFPPPPYPFTPPTPPYYPPPPYPYYTTPP 44 6 NE 45 1 2 1 CCCPPPCPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPYPPPPPPPPPPPPCPPPPPPYPPPYPPPPPPPPYPPPPPPYPPPYY PP 45 1 8 8
453. R 3 ml 300 mg 20 8 ml ml 2x1 ml 2x50 ml mm e2x1ml e4x1ml 2x50 ml 189 E DIG DIG DNA Molecular Weight Marker IL 1 218 590 e5phg 500 pl DIG labeled 5 DNA Molecular Weight Marker II e1218 603 e5phg 500 pl DIG labeled 5 DNA Molecular Weight Marker V 1 669 931 e5phg 500 pl DIG labeled 5 DNA Molecular Weight Marker VI 1 218 611 e5pg 500 pl DIG labeled 5 DNA Molecular Weight Marker VII 1 669 940 5pg 500 pl DIG labeled 5 DNA Molecular Weight Marker VIII 1 449 451 e5pg 500 pl DIG labeled 5 RNA Molecular Weight Marker I 1 526 529 4pg 200pl DIG labeled 5 RNA Molecular Weight Marker II 1 526 537 e2pg 200pl DIG labeled 5 RNA Molecular Weight Marker III 1 373 099 e2pg 200pl DIG labeled 5 DIG Actin RNA Probe DIG labeled 1 498 045 2 nd DIG labeled Control DNA 1 585 738 50 pl DIG labeled Control RNA 1 585 746 50 pl 190 E DIG Non RI Biotin High Prime 1 585 649 Biotin RNA Labeling Mix 1 685 597 DIG DNA Labeling Mix 5 1 277 065 DIG High Prime 2 1 585 606 DIG RNA Labeling Mix 5 1 277 073 Fluore
454. RNA T DNADNA T 159 159 160 24 158 160 159 RNA 62 Transcription vector Transfer buffer Transparancy technique TRF Troubleshooting for PCR labeling Random primed labeling RNA transcriptional labeling Two probes on same blot U Unincorporated DIG UV crosslinking V Vector sequences elimination of W Washes stringent Washing buffer Wash temperature Western blot assay nonradioactive X X phosphate see BCIP Y Yield of labeling probe estimating Yield of labeling probe For random primed labeling 62 88 95 133 TRF 145 PCR 59 50 RNA 71 2 135 DIG 103 UV 88 99 46 28 160 28 160 28 160
455. Tips on Working dilution of chemiluminescent detection chromogenic detection Antisense RNA Application for DIG labeling B Background Irregular cloudy Irregular smeared grainy Nonspecific On one part of membrane Spotty Uniform high Baking DNA on membrane BCIP Blocking reagent Blocking solution Blot Membranes different types of Storage of Blot transfer Advantages of Blot transfer Amount of salt to use Buffers for Choosing a method 6 DIG 26 29 DIG 11 19 Gel DNA Extraction Kit 46 174 MP 35 130 169 179 31 122 121 186 29 107 30 115 29 161 19 PCR 57 DIG 4 DIG 181 DIG 108 DIG 117 RNA 62 DIG
456. Transparency 1 15 2 2 40 ml 30 5 3 DIG 15 ml 1 10000 30 4 2 1 40ml 15 X 2 5 20 ml 2 5 6 3 7 100 cm 5 500 25 mM CSPD 2 1 100 0 25 mM CSPD ready to use 25 mM CDP Star 1 200 1 500 0 25 mM CDP Star ready to use 1 2 1 5 8
457. Tris HCI 1 mM EDTA pH 8 0 DIG DIG 6 6 1 2 6 1 2 1 1 2 5 129 RN 6 1 2 2 DIG DNA 3 75 132 6 1 2 3 133 A 35 B DIG 30 C 30 6 1 2 3 D1 CSPD
458. ases Promoter sequences for RNA separating on gels RNase contamination preventing Protection assay Protection Kit T1 rRNA sigpnals on blot unwanted S Salt crystals on membrane Salt for blot transfer amount to use Sandwich blot transfer Screening colonies and plaques Sensitivity Of DIG labeling Of DNA and RNA probes comparison Of oligonucleotide probes 165 7 K 175 20 PCR 54 45 RNA 66 75 121 43 49 50 173 Rapid DNA Ligation Kit 66 DIG E 188 31 122 64 67
459. bridization Formaldehyde Four base cutter Fragile X DIG DNA DIG DMDC DNA DNA DNase I DIG E EMSA DIG PCR Expand High Fidelity Expand Long Template li DNA
460. c Alkaline phosphatase substrate Detection results Detection tequnique Chromosomal DNA interference of Cleaning dirty probes Colony hybridization Typical results with Color substrate Comments on DIG abeling methods Comparison of DNA and RNA probes mRNA and total RNA probes PCR DIG Labeling Mix and PCR DIG Probe Synthesis Kit Popular labeling methods Concentration of template Controls DIG labeled CSPD Cycler settings for PCR labeling Production of RNA labeling template 103 88 21 88 183 184 183 184 159 21 87 177 CDP Star 29 131 171 174 22 PCR 57 29 113 106 110
461. ck Translation Nonradioactive Detection of PCR production ona gel PCR 51 43 74 11 73 RNA 62 11 11 11 DIG 33 126 7 50 59 71 28 Lumi Film 107 LumiLight Western Blotting Substrate 139 Lumi Light Ms Western Blotting Kit 139 Lumi Light Ms Western Blotting Substrate 139 186 165 146 146 46 168 163 169
462. cking Reagent 1 096 176 DIG Easy Hyb 1 603 558 DIG Easy Hyb Granules e1796 895 DIG Control Teststrips 1 669 966 DIG Quantification Teststrips 1 669 958 DIG Wash and Block Buffer Set 1 585 762 Digoxigenin 3 0 methylcarbonyI 1 333 054 aminocaproic acid N hydroxy succinimid eester DIG NHS Hexanucleotide Mix 277 081 Hybridization Bags 1 666 649 Lumi Film Chemiluminescent 1 666 916 Detection Film 1 666 657 Nylon Membranes positively charged 209 272 209 299 1 417 240 Nylon Membranes for Colony and Plaque 1699075 Hybridization 1 699 083 e509g 500 ml 6x100ml 25 50 1 30 5md 100nl 50 50 25 x 24 cm 100 18 x 24 cm 100 20 3 x 25 4 cm 10 20 x 30 cm 20 10 x 15 cm 0 3 x 3 m 50 82 mm 50 132 mm Agarose LE 1 685 660 1 685 678 Agarose LM MP 1 441 345 441 353 Agarose MP 1 388 983 1 388 991 Agarose MS 1816 586 1 816 594 192 e100 g 500 g 50 g e100 g e100 g 500 g e100 g 500 g E
463. cm 10 ml DIG Easy Hyb 3 5 ml DIG Easy Hyb DIG Easy Hyb 1 Cat No 1 666 649 2 3 NH4 pH 89 DIG
464. d Schuell 43 2 13 62 2 13 73 2 73 2 DIG PCE VA 2 PCRH RNA PCR RNA 3 DIG 3 PCR DIG DIG RNA DI
465. ds Chemiluminescent methods Chomogenic methods Differential mobility of DNA protein complexes DIG basics Summary of DIG dUTP to dTTP ratio effects of DIG Easy Hyb Amount required for hybridization DIG Gel Shift Kit DIG High Prime Kit DIG labeled DNA probe Storage of DIG labeled probe concentration of DIG labeling see Labeling DIG laboratory equipping DIG Northern Starter Kit DIG Oligonucleotide Labeling Kits Digoxigenin DIG Product Selection Guide DIG System General precautions Improving results Overview Products ordering information for Appendix E Troubleshooting DIG Tailing Kit DIG Wash and Block Buffer Set Dilution of probe Dimethylformamide Direct detection assay Overview of Evaluation of Procedure 146 47 56 183 46 DEPC 184 176 183 186 29 Lumi Imaser 146 29 106 DNA 149 29 106 115 DNA 149 DIG 156 DI
466. even distribution of Problems with background see Background Procedures list of Proteinase K Pulse field gel electrophoresis Purification of template For PCR labeling For randam primed labeling For RNA transcriptional labeling Q Quantification Of labeled probe R Rainbow detection Random primed labeling technique Critical hints about Troubleshooting for Typical results with Rapid DNA Ligation Kit Reagents for DIG System Appendix E Reprobing membrane Reverse transcriptase Roller bottle RNA alkali treatment of RNA electrophoresis RNA labeling Critical hints about Troubleshooting for Typical results with RNA loading buffer RNA polymerases Promoter sequences for RNA separating on gels RNase contamination preventing Protection assay Protection Kit T1 rRNA signals on blot unwanted S Salt crystals on membrane Salt for blot transfer amount to use Sandwich blot transfer Screening colonies and plaques Sensitivity Of DIG labeling Of DNA and RNA probes comparison Of oligonucleotide probes 165 7 K 175 20 PCR 94
467. gh Fidelity System Expand Long Template System DIG 7jp 1 20 PCR DIG Labeling Mix Cat No 1 585 550 3 6 3 PCR 2 DNA 10 pg DNA 10 ng DNA 105 3 3 2 1 DIG
468. gh Prime Labeling and Detection Starter Kit ll 2 DIG Oligonucleotide 3 End Labeling Kit 2nd generation 6 3 DIG Northern Starter Kit 75 NISAS S TT tJ DIG 2 gt 2 5 2 5 2 _ 2 5 2 1 15 77 2 5 2 2 G 2 2 5 80
469. ic acids Critical hints about Electrostatic charge EMSA End Labeling Kit Equipping a DIG laboratory Estimation of PCR labeling Estimation of probe labeling Ethidium bromide staining technique Ethidium bromide sensitivity of Exon intron structure of genes Expand High Fidelity Enzyme Blend Expand Long Template Enzyme Blend Evaluation of probe labeling F Filtration Chemiluminescent detection of probes on a blot Chromogenic detection of probes on a blot Colony hybridization Estimation of probe yield Hybridization of DNA probes to a Southern blot Hybridization of RNA probes to a Northern blot Flow chart for Labeling of RNA probes PCR labeling or probes Performing a DIG abeling and detection experiment Plaque hybridization Random primed labeling Forceps Formamide Effect on hybridization Formaldehyde Four base cutter Fragile X DIG DNA DIG DMDC DNA DNA DNase I DIG EMSA
470. imating Yield of labeling probe For random primed abeling 62 88 95 133 TRE 145 PCR 59 50 RNA 71 2 135 DIG 103 UV 88 99 46 28 160 28 160 28 160 139 X PCP 75 48 205 PCR 206 PCRH PCR License Disclaimers 1 Hoffmann La Roche Inc F Hoffmann La Roche Ltd Roche PCR PCR
471. ml 2 2 100ml 30 30 77 p 3 20ml 30 8930 100 ml 15 x 2 2 x 15 20 ml 83 3
472. ny DIG UTP UTP 2 DIG 2 10 2 32P 10 zg RNA GAPDH PR1b mRNA X 36
473. scein High Prime 5 1 585 622 PCR Fluorescein Labeling Mix 1 636 154 Fluorescein RNA Labeling Mix 1 685 619 PCR DIG Labeling Mix PLUS 5 1 835 289 Nick Translation Mix 1 745 808 DIG Nick Translation Mix 1 745 816 Biotin Nick Translation Mix 1 745 824 Non RI Biotin 16 ddUTP 1 427 598 Biotin 16 dUTP 1 093 070 Biotin 16 UTP 1 388 908 Digoxigenin 11 ddUTP5 1 363 905 Digoxigenin 11 dUTP alkali labile 5 1 573 152 1 573 179 Digoxigenin 11 dUTP alkali stable 9 1 093 088 1 558 706 1 570 013 Digoxigeinin 11 UTP 1 209 256 Fluorescein 12 dUTP 1 373 242 Fluorescein 12 UTP 427 857 TetramethyI rhodamine 5 dUTP 1 534 378 100 pl 25 40 nl 20 50 pl 25 160 pl 40 40 nl 20 100 pl 25 100 pl 10 40 nl 20 2x250nul 2 x 50 e 200 pl e 160 pl e160 pl 25 nmol 25 ul 50 nmol 50 pl 250 nmol 25 pl 25 nmol 25 pl 25 nmol 25 ul 125 nmol 125 pl 25 nmol 25 nl 125 nmol 125 pl 5x125nmol 5 x 125 pl 250 nmol 25 pl 25 nmol 25 pl 250 nmol 25 pl 25 nmol 25 ul 191 E DIG Cat No Blo
474. tase Chemiluminescent Chromogenic Overview T Table of procedures Tailed oligonucleotide probe Tailing Kit Target nucleic acid Amount required on gel Concentration of Degraded Electrophoresis of Fixation to gel Too much TE buffer Telomere Telomere length assay Telomeric DNA TeloTAGGG Telomere Length Assay TeloTAGGG Telomere PCR ELISA Template Concentration Contamination in Purification see Purification of Template Three probes on same blot Tho Calculating For DNA probes For oligonucleotide probes For RNA probes T of oligonucleotides T of DNA DNA hybrid Transcriptional labeling of RNA DNA RNA DIG DNA 19 87 20 97 122 171 84 88 16 75 2 65 DNA 48 58 93 99 RNA 69 70 122 31 122 123 Tips 31 24 28 28 29
475. the links belnw Disease amp Drug Research Please bookmark this site and consult it regularly to learn all about the latest information on DIG reagents and related products and techniques Application Information Product Information Communication Why non radinactive Product selectinn Representatives labeling guide DIG systern basics Product list Feedback Non radipactive vs Dig FAOs Online Technical radinactive labeling Support Application hints Slide show Literature DIG DIG DIG Non RI Non RI P DIG DIG p Non RI RI DIG RI P
476. tion 850 Hincoln Center Drive Fos ter City California 94404 Roche Mo ecular Systems Inc 1145 Atlantic Avenue Alameda California 94501 2 Hofimann La Roche Inc F Hoffmann La Roche Ltd Roche U S Patent 4 683 202 4 683 195 4 965 188 up front fee component running roy alty component PCR
477. ue List of procedures Low labeling efficiency Low stringency wash Lumi Film Lumi Light Western Blotting Substrate Lumi Light Ps Western Blotting Kit Lumi Light Ms Western Blotting Substrate M Maleic Acid Buffer Magnesium ions Mapping transcriptional start sites Mapping transcriptional termination sites Maxi preps Membrane Diffuse bands on Letting dry out Missing bands on Problems with background see Background Reprobing Salt crystals on Stripping Unsuitable Methods for DIG labeling Mini preps Mock hybridization Molecular weight marker MOPS mRNA detection of rare mRNA Isolation Kit N NBT BCIP Neutralization of gels NGF mRNA Nick Translation Nonradioactive Detection of PCR production ona gel PCR 51 43 74 11 73 RNA 62 11 11 11 DIG 33 126 7 50 59 71
478. ular Systems Perkin EImer Corporation 207 1 Roche Molecular Systems Perkin EImer Corporation PCR 206 2 DIG MA DNA RNA SP6 T7 T3 DNA
479. y HyD DNase RNase DIG Easy Hyb ready to use Cat No 1603 558 DNase RNase DIG Easy Hyb Cat No 1 796 895 DIG High Prime Labeling and Detection Starter Kit I II Cat No 1 745 832 1 581 641 64 ml DMDC DEPC 2 1 37 5 DIG Easy Hyb RNA 2xSSC 20 x SSC 1 10 0 1 SDS 10 SDS 1 100 0 1 x SSC 20 x SSC 1 200 20 x SSC 2 0 1 SDS 10 SDS 1 100 RNA 50 50 mM Tris HC1 pH 7 5
480. ylinker Popular DIG labeling methods Prehybridization Pretreatment of gel before blot transfer Prewarming wash buffers Probe hybridization Concentration during hybridization Denaturation of Effects of too little Effects of too much Filtration of Homology with target Labeling estimation of 149 RNase 146 142 139 94 63 N RAS 121 126 22 Oct2A 151 74 73 74 158 PCR 58 DIG 11 PCR DIG Labelng Mix 151 PCR DIG Probe Synthesis Kit 153 PCR DIG Labeling Mix 153 PCR DIG Probe Synthesis Kit 52 PCR DIG Labeliing Mix 153 PCR 202 58 59 61 PFGE 20 126

Download Pdf Manuals

image

Related Search

Related Contents

ExcelStor Jupiter ESJ9250/ESJ9160  CIRRUS DESIGN SR22  PDF Handbuch des Herstellers  OPERATOR`S MANUAL 26cc 2-CyCLE POWER HEAD    WIDNEY LEISURE LTD.    Consulter / Télécharger le plan du réseau    Fiche Intervenant  

Copyright © All rights reserved.
Failed to retrieve file