Home
PACS Abstract Submitter User Guide
Contents
1. Table l 3 CR e The Disclosure section requires the following rule to be met for the question pertaining to the Abstract will be withdrawn if Preprints author cannot attend Preview i Question must be answered Submit f Program Options Edit My Submission The Disclosure section requires the following rule to be met for the question pertaining to the Abstract submitted only once Question must be answered The Disclosure section requires the following rule to be met for the question pertaining to the Preferred Presentation Method A response is required e The Abstract Title section requires the following rule to be met for the question pertaining to the Title A response is required e At least one Author is required e You must insert the figure1 tag within your document body in order to include your figure 1 in the submission Once all errors have been corrected and the abstract fields have a green check mark you may submit your abstract 14 Page PACS Abstract Submitter User Guide Visa Letter Disposition Letter Personalized visa letters are available to download only after your abstract has been accepted by the symposium organizer or program chair PLEASE NOTE Visa letters are only generated for presenting authors and can only be downloaded from the account of the person who submitted the abstract To download a visa letter 1 Log into PACS using your ACS ID and password 2 Click the preview H i
2. it is the final draft 5 Page PACS Abstract Submitter User Guide Authors and Institutions Enter Institutions Enter Institutions To enter all institution information on this screen click on the plus sign in the box below under Create Edit Institution Department City Town State Province Country Create Edit Delete To Enter an Institution 1 Click on the plus fl under Create Edit 2 Enter the following information e Institution Company Name PLEASE NOTE Presenting or co authors without a company or institution should enter Unaffiliated e Department optional e City Town optional e State Province optional e Zip Postal Code optional e Country 3 Click Save 4 Click on the pencil to edit the institution information Repeat steps 1 3 to enter institution affiliation information for all persons to be named on the abstract PLEASE NOTE Do not enter the same institution more than once unless you are listing different departments of the institution Authors can be linked to the same institution Enter Authors Enter Authors 1 Enter all author information on this sc The nforma s s formatted late ordin gie specifications determined by Ame Chemical eech Howe all data entry ase sensitive capital lett ii ow se lette ei e appear exactly as you enter them Authors will be printe Sate the sequ order yo api entered 2 On the printout the names of the authors will be listed along with the institution inf
3. projector with VGA connection cable and switcher Screen Laser pointer and Lighted podium with microphone e Do you have comments to organizers e What presentation method do you prefer e Should your abstract be considered for a Sci Mix Click Save to save the information To move to the previous or next page click Previous and Next respectively PLEASE NOTE The pages will automatically save the information on the page when you click Previous or Next 8 Page PACS Abstract Submitter User Guide Abstract Title Guidelines for Entering a Paper Title e Capitalize only the first letter of the title any proper nouns or acronyms and the first word following a colon e Do NOT put your title in ALL CAPS e Do NOT begin paper titles with The A or And These will be removed before publication e Do NOT end titles with a period e Do NOT make your title bold e Use the icons to subscript or superscript text e Use character map 42 to select custom characters symbols Sample Title Engineering gene expression of Escherichia coli by mRNA Applications in molecular biology Abstract Title Denotes required field Guidelines for Entering a Paper Title 1 Capitalize only the first letter of the title any proper nouns or acronyms and the first word following a colon Example Engineering gene expression of Escherichia coli by mRNA Applications in molecular biology Do not put your title
4. AA ACS Chemistry for Life PACS Abstract Submitter User Guide Table of Contents Updated 3 2012 PACS Abstract Submitter User Guide Getting Set up as an Abstract Submitter 0 c cece cece cence ee eee ees Creating a New AbStract cc ccc cece cece cence eens ee eneteenaeeeeaeeeeseneeaas Submission Instructions Authors and Insttuhons DISCIOSUIC 2 cc ccc ccccccccccucucaccccuceuauuetucuuauuutuuuuannutuuauaunusunansuuusunas Abstract Te UCN 62 i en ne eee ee eer Figures optional Tables lee EI UNENEE SN nl Cru UE Visa Letter Disposition Leiter 00 0 cccce cee cec cece eeseeeeeeeseeeeeneas CUE eC ee Getting Setup as an Abstract Submitter 2 Page PACS Abstract Submitter User Guide In order for you to submit an abstract you must have an ACS ID If you have ever signed in at www acs org then you already have an ACS ID You can use the same ACS ID you use to log into the ACS Homepage to submit an abstract How to Get an ACS ID lf you do not already have an ACS ID 1 Goto the PACS login page at hitp abstracts acs org 2 Click Registering is easy 3 Create your username and password and select the appropriate relationship to ACS 4 When you have successfully created an ACS ID return to the PACS login page at http abstracts acs org and sign in Login ACS Journals C amp EN CAS AAN ACS ACS Network Store Governance About Us Cont
5. NAL MEETING PASADENA CA Western Regional Meeting 2011 SOUTHWEST 2011 REGIONAL MEETING Southwest 2011 Regional Meetin SERMACS 2011 SERMACS 2011 To view the symposia available to submit to for each program area 1 Click the plus K next to a program area 2 Select the symposium you wish to submit your abstract to 3 Click Save Please select the program area in which you would like to submit your paper L 3 AGFD Division of Agricultural and Food Chemistry 5 ANYL Division of Analytical Chemistry 4 BIOL Division of Biological Chemistry 4 BIOT Division of Biochemical Technology 2 BMGT Division of Business Development and Management Cr CARB Division of Carbohydrate Chemistry E 2011 Wolfrom Isbell and Young Investigator Award Symposium Oral 2012 Wolfrom Isbell and Young Investigator Award Symposium Oral E SEFA ORIST Host Pathogen Interactions and Their Interventions Oral niemer rriti nee eT Biology and Drug Discovery Oral mM E General Pen GE oral Ei General Papers Synthetic Chemistry Oral E General Posters Poster E Symposium in Memory of Dr David Gin Oral CATL Division of Catalysis Science and Technology 2 CELL Division of Cellulose and Renewable Materials 3 CHAL Division of Chemistry and the Law 4 CHAS Division of Chemical Health and Safety CHED Division of Chemical Education 4 CINF Division of Chemical Information d 4 Page PACS Abstract Submitter User Gu
6. Scientific Workforce Development Blurring the Line Between Science and Business Education INSTITUTIONS 1 ACS United States AUTHORS 1 John Smith 1155 16th Street NW Washington DC 20036 United States 555 555 5555 abstract acs org lf all the information has been entered correctly you will be directed to screen indicating that your abstract has been successfully submitted You will also receive a submission confirmation email Error Messages If you have information missing from your submission the Document Submission Error A icon will appear A list of areas that need to be revisited and corrected will be listed Navigate to the areas with the red exclamation mark on the left had navigation bar Le Submit sw Division and Committee Instructions The accuracy of your submission is your responsibility Please proofread your document carefully before submitting it DOCUMENT SUBMISSION ERROR Authors amp Institutions E EEN j SE You must complete the following missing information fields in order to complete your document submission Disclosure e The Disclosure section requires the following rule to be met for the question pertaining to the Reason for Abstract Submission Abstract Title A response is required v Abstract Body D The Disclosure section requires the following rule to be met for the question pertaining to the Presenting author will register Poe Question must be answered
7. User Guide Figures optional Figures pictures images are optional for abstract submissions You are allowed a maximum of 2 tables and or figures A figure counts for a total of 70 words and counts towards the allowed 150 words for the abstract body Upload a figure 1 Click Browse 2 Locate the figure you wish to add images will be accepted in one of the following formats gif jpg jpeg or png The maximum file size is 2MB 3 Click upload et Add Figure to Abstract Body To include a figure within your submission you must use a Figure ID tag in the abstract body 1 Enter the Figure ID tag with brackets i e figure1 or figure2 in the abstract body where you would like your figure displayed PLEASE NOTE Figure ID tags are case sensitive and need to be in lowercase type without spaces 2 Preview your submission and figure location by using the Preview link from the left navigation bar Figure Add Figure After reserving space for a figure s and selecting the number of figure s that will be included in your document body maximum of 2 tables and or figures you must then upload any figure s that fit the upload criteria A figure counts for a total of 70 words To include a figure within your submission you must use a Figure ID tag in the document body L Enter the Figure ID tag with brackets i e figurei in the document body where you would like your figure displayed 2 Preview your submission and figure lo
8. act A Chemistry for Life JoinACS mae Publications Meetings Careers Membership amp Networks Education Policy Funding amp Awards Press Room American Chemical Society LogIn e Log In ACS ACS Program and Abstract Creation System Chemistry for Life PACS User Name Please use your ACS ID to log in to the Program and Abstract Creation System Use this system to view modify or withdraw an Password abstract or preprint download a visa letter for ACS National Meetings and carry out your tasks as program chair or symposium organizer Please send questions or comments to pacs acs orq More about ACS IDs What is an ACS ID The ACS ID is a single set of log in credentials e user name and password used to access multiple ACS online products including ACS Publications journals C amp EN Online e www acs org e ACS Network How to Submit an Abstract 1 Goto the PACS login page at hitp abstracts acs org 2 Log in using your ACS ID 3 Select a meeting on the landing page Creating a New Abstract 3 Page PACS Abstract Submitter User Guide Once you have logged in to PACS at hitp abstracts acs org using your ACS ID you will be able to select a meeting to submit your abstract to Please select below the meeting program to access 243RD ACS NATIONAL MEETING SAN DIEGO CA 243rd National Meeting 242ND ACS NATIONAL MEETING DENVER CO 242nd National Meetin 43RD WESTERN REGIO
9. cation by using the Preview link from the left navigation bar Please note Figure ID tags are case sensitive and need to be in lowercase type without spaces Images will be accepted in one of the following formats when using the upload process gif jpg jpeg png The maximum file size cannot exceed 2mb 2 000 000 A ure ID Figure Name Preview Delete chrysanthemum jpa EN ES Add New LR Click Save to save the information To move to the previous or next page click Previous and Next respectively PLEASE NOTE The pages will automatically save the information on the page when you click Previous or Next 11 Page PACS Abstract Submitter User Guide Tables optional Tables are optional for abstract submissions You are allowed a maximum of 2 tables and or figures A table counts for a total of 70 words and counts towards the allowed 150 words for the abstract body Create a table 1 Enter the number of columns and number of rows of your table The maximum number of columns is 8 2 Click Create 3 Once the table is created you may add delete and edit the individual cells of your table You may add Greek characters special symbols and special formatting to your table by using the character insert options 4 When you have finished creating your table click Save Edit a Table e You can edit a table by clicking the Edit Table icon e You can preview the table by clicking the Preview Table icon B e You can
10. con under Disposition Letter next to the abstract you wish to download a visa letter for Document Submission Edit Preview PrePrint i itio Withdraw Number Status Document Document l Document Not COMSCI Committee on Accepted Available Science Incomplete Not Not GEOC Division of p en Available Available Geochemistry PMSE Division of Polymeric Materials P Not Not Science and Engineering Available Available Incomplete 3 Click View Leiter next to the name of the presenting author s personalized visa letter you want to download Chemistry for Life American Chemical Society Department of Meolings and Expostons Mee Saas ae Tan oe Tel 202 2 4600 E Mail patinnsleaniree tare ong URL Aitosacs orgimeetings October 12 2017 1 oa de SECH 2012 in San California Eech national meetng is announced io the saontific community gun publication of the call ior papare and tha the Sociais official publication Chemical amp Engineering Mews C amp EN Additional meeting infonmaion can be found e mares nd orca fe II 4 Print or save the visa letter by clicking on the print or save Al icons 15 Page PACS Withdrawing Abstracts Abstract Submitter User Guide Abstracts may be withdrawn from your Abstract Submitter Dashboard by clicking on the delete I icon next to the abstract that you wish to withdraw under Withdraw Document Document Submission Edit Preview 5 pri
11. delete a table by clicking the Delete Table icon EI Table ID Edit Table Preview Table Delete Table tablei g pI Edit New Table Dimensions Create Previous Next Add Table to Abstract Body To include a table within your submission you must use a Table ID tag in the abstract body 1 Enter the Table ID tag with brackets i e table1 or table2 in the abstract body where you would like your table displayed PLEASE NOTE Table ID tags are case sensitive and need to be in lowercase type without spaces 2 Preview your submission and table location by using the Preview link from the left navigation bar Click Save to save the information To move to the previous or next page click Previous and Next respectively PLEASE NOTE The pages will automatically save the information on the page when you click Previous or Next 12 Page PACS Abstract Submitter User Guide Preprints Preprints are only required for ENFL POLY and PMSE divisions If you submit a preprint for any other Division it will be disregarded Add Preprint Upload your MS Word version of your preprint using the division template if provided PLEASE NOTE Do not upload a PDF only uploaded the MS Word file 1 To upload a preprint click Browse 2 Locate the MS Word document you wish to upload 3 Click the upload ep icon Preprints Use the upload feature below to upload your MS Word version of you preprint using the division template if pr
12. ide Submission Instructions On the Submission Instructions page you can find e detailed instructions on how to navigate through the submission site e links to program chair and symposium organizer contact information e links to division and committee abstract submission deadlines Logout AC a ACS y Chemistry fo kieweP Lune Mach Division and Committee Instructions Welrome te the Abstract Subminsian Program tor The Anverican Chemical Seciely Io real he gaben enetruchord apeotc te the Dritan thet wou mre eubmeing te vou Gen find that Drekan name belge ONLINE SUBMIS SIL NJI ES E GSS POL SLO Navigation Instructions 1 Click the button on the left side of the screen and complete each section Be sure to carefully follow the instructions within each section When the section is completed you will see a green check 1 2 Save your work by clicking Save on each page This does not submit your abstract for review Be sure to save your work before logging off the site 3 You can log off at any time without submitting your abstract You may return to the site at any time prior to the submission deadline to edit your abstract even if you have submitted your abstract 4 Verify that your abstract is correct by clicking Preview Abstract 5 Print out and proofread the abstract preview to verify that it is correct before completing the submission 6 Click Submit ONLY when you have completed your abstract and
13. in ALL CAPS Do not begin paper titles with The A or And These will be removed before publication Do not end papers with a period Dm w M Do not make your title bold E 7 U ae x Al Click Save to save the information To move to the previous or next page click Previous and Next respectively PLEASE NOTE The pages will automatically save the information on the page when you click Previous or Next 9 Page PACS Abstract Submitter User Guide Abstract Body e The size limit for the abstract is 150 words including Abstract Body Tables and Figures each figure counts for 70 words e Use the icons to subscript or superscript text e Use the character map 2 to select custom characters symbols e Do NOT include the abstract title in the abstract body Abstract Body The size limit for the abstract is 150 words including the following Abstract Body Tables and Figures To insert Greek or other special characters select the Character Map located in the bottom right corner of each text area To include a figure in your abstract enter the tag figurei in the body text Enter abstract body here E FU asc x Al D Previous Save Next Click Save to save the information To move to the previous or next page click Previous and Next respectively PLEASE NOTE The pages will automatically save the information on the page when you click Previous or Next 10 Page PACS Abstract Submitter
14. ns to be named on the abstract 7 Page PACS Abstract Submitter User Guide Disclosure The disclosure page Is a list of questions presented to the submitter regarding the abstract submission The questions are answered by simply selecting YES or NO for each question or selecting from a set of options Disclosure Denotes required field Are you submitting your abstract in response to the Call for Papers or from a specific invitation to present I am contributing this paper in response to the Call for Papers G Iwas specifically invited to submit this paper Invited speakers enter the name of the symposium organizer or program chair who invited you Enter the email address of the symposium organizer or program chair who invited you Below are some of the questions included on the disclosure page e Are you submitting your abstract in response to the Call for Papers or from a specific invitation to present e Are the criteria outlined in ACS Bylaw VI Section 6 3 met For contributed papers only e fthe abstract is accepted will the presenting author register for the meeting and make the presentation oral or poster based on this abstract e lf the presenting author or co author cannot attend the meeting will the abstract be withdrawn from the national meeting e This abstract will only be submitted once to the national meeting e Do you have any equipment needs All technical session rooms are equipped with LCD
15. nt Number Status Document Document aak DES E 3 Hot Al EE d Available Ss er Not 10969 Incomplete rd Available OH S Not 12227 Incomplete P Avaiable Disposition Letter Not Available Not Available Program Withdraw Area Document COMSCI Committee on ye e CN Science GEOC Division of Not Geochemistry Available PMSE Division of Polymeric Materials dere ee GENEE Available Science and Engineering lf the option is not available please send a withdrawal request to pacs acs org with the following information e Abstract ID number e Abstract title e Author s name s e Division abstract was submitted to e Final paper number if available 16 Page
16. ormation To Enter an Author 1 Click on the plus under Create Edit 2 Select Presenting or Contributing Author 3 Enter the following information 6 Page PACS Abstract Submitter User Guide e Title Degree optional e First Name e Middle Initial optional e Last Name e Suffix optional 4 Select an Affiliation PLEASE NOTE You must select an affiliation s that you previously entered even if you only entered one institution You may select more than one by holding the Ctrl key and clicking the appropriate affiliations e Affiliations At feast one instution must be selected This will be what is printed in the author string To select more than one institution hold down the Ctr key and click the additional institution s 1 Department of Volunteer Support ACS PLEASE NOTE If the person named above is a presenting author you will need to complete the contact information below This can be the contact information for the presenting author or an assistant information as this is only used for correspondence 5 Enter the following information e Institution optional e Department optional e Address e City Town e State Province optional enter information if applicable e Zip Postal Code optional enter information if applicable e Country e Phone Number e Fax optional e E mail 6 Click Save 7 Click on the pencil to edit the author information Repeat steps 1 6 to enter author information for all perso
17. ovided Preprints are only required for ENFL PMSE and POLY divisions If you submit a preprint for any other Division it will be disregarded To download the preprint template for your division you can find this on the Division Instructions page or click the link below Click for ENFL Preprint Template Click for PMSE Preprint Template Previous Baue Next Edit Preprint Upload your edited MS Word version of your preprint 1 To upload the edited preprint click Browse 2 Locate the edited MS Word document you wish to upload 3 Click the upload eg icon The old preprint will automatically be replaced by the new preprint Click Save to save the information To move to the previous or next page click Previous and Next respectively PLEASE NOTE The pages will automatically save the information on the page when you click Previous or Next 13 Page PACS Abstract Submitter User Guide Submit The accuracy of your submission is your responsibility Please proofread your document carefully before submitting it Once you have completed your abstract click Submit Final Document Submit The accuracy of your submission is your responsibility Please proofread your document carefully before submitting it Submit Final Document 243rd ACS National Meeting San Diego CA Document ID 10560 Program Area COMSCI Committee on Science Symposium Title COMSCI003 Emerging Models for Strengthening Science Education Toward
Download Pdf Manuals
Related Search
Related Contents
CPU 評価ボード 取扱説明書 manual uprights.cdr RCA IP115 User's Manual delta 10 f zoom VPS Hydro Putty Acer K K202HQL Autologue User`s Manual – Part Sourcing Page i Table Of Contents poR FaVoR, Lea atentamente todas Las instRUcciones antes de Copyright © All rights reserved.
Failed to retrieve file